Incidental Mutation 'R2080:Ktn1'
ID 229437
Institutional Source Beutler Lab
Gene Symbol Ktn1
Ensembl Gene ENSMUSG00000021843
Gene Name kinectin 1
Synonyms
MMRRC Submission 040085-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2080 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 47886551-47974021 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47963417 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1164 (E1164G)
Ref Sequence ENSEMBL: ENSMUSP00000140324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022391] [ENSMUST00000185343] [ENSMUST00000185940] [ENSMUST00000186627] [ENSMUST00000186761] [ENSMUST00000187039] [ENSMUST00000190252] [ENSMUST00000188553] [ENSMUST00000190182] [ENSMUST00000190535] [ENSMUST00000188330] [ENSMUST00000189533] [ENSMUST00000187839] [ENSMUST00000187262] [ENSMUST00000189101] [ENSMUST00000189986] [ENSMUST00000190999] [ENSMUST00000191018] [ENSMUST00000191511] [ENSMUST00000191446]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000022391
AA Change: E1164G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022391
Gene: ENSMUSG00000021843
AA Change: E1164G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1267 N/A INTRINSIC
coiled coil region 1302 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185343
SMART Domains Protein: ENSMUSP00000140186
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185940
SMART Domains Protein: ENSMUSP00000139625
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
coiled coil region 1198 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186627
SMART Domains Protein: ENSMUSP00000140873
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186761
AA Change: E1135G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139521
Gene: ENSMUSG00000021843
AA Change: E1135G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187039
SMART Domains Protein: ENSMUSP00000140202
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
coiled coil region 1198 1222 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190252
AA Change: E1135G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140011
Gene: ENSMUSG00000021843
AA Change: E1135G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1210 N/A INTRINSIC
coiled coil region 1245 1269 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188553
AA Change: E1141G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140865
Gene: ENSMUSG00000021843
AA Change: E1141G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1216 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190182
AA Change: E1135G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140301
Gene: ENSMUSG00000021843
AA Change: E1135G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1238 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190535
AA Change: E1141G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139952
Gene: ENSMUSG00000021843
AA Change: E1141G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1244 N/A INTRINSIC
coiled coil region 1279 1303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188330
AA Change: E1112G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140845
Gene: ENSMUSG00000021843
AA Change: E1112G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1187 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189533
AA Change: E1112G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140142
Gene: ENSMUSG00000021843
AA Change: E1112G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1187 N/A INTRINSIC
coiled coil region 1222 1246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187839
AA Change: E1164G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140324
Gene: ENSMUSG00000021843
AA Change: E1164G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1267 N/A INTRINSIC
coiled coil region 1302 1326 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188263
Predicted Effect probably benign
Transcript: ENSMUST00000187262
SMART Domains Protein: ENSMUSP00000140206
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189101
SMART Domains Protein: ENSMUSP00000140178
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189986
SMART Domains Protein: ENSMUSP00000139970
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
Pfam:Rib_recp_KP_reg 29 172 2.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190999
AA Change: E1112G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139673
Gene: ENSMUSG00000021843
AA Change: E1112G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1215 N/A INTRINSIC
coiled coil region 1250 1274 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190857
Predicted Effect probably benign
Transcript: ENSMUST00000191018
SMART Domains Protein: ENSMUSP00000139585
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1220 N/A INTRINSIC
coiled coil region 1255 1279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191511
SMART Domains Protein: ENSMUSP00000139946
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1192 N/A INTRINSIC
coiled coil region 1227 1251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191446
SMART Domains Protein: ENSMUSP00000140748
Gene: ENSMUSG00000021843

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1215 N/A INTRINSIC
coiled coil region 1250 1274 N/A INTRINSIC
Meta Mutation Damage Score 0.1474 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation or a floxed allele exhibit no discernable phenotype; mice are viable and fertile up to one year of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,119,792 (GRCm39) D183V probably damaging Het
Ambra1 T A 2: 91,716,064 (GRCm39) D858E probably damaging Het
Amdhd2 T C 17: 24,375,578 (GRCm39) T370A probably benign Het
Amy1 A G 3: 113,351,743 (GRCm39) W449R probably benign Het
Aox3 A T 1: 58,225,439 (GRCm39) I1179F probably benign Het
Atp10a C A 7: 58,474,075 (GRCm39) Q1121K probably damaging Het
Btaf1 C T 19: 36,928,548 (GRCm39) A123V probably benign Het
Car6 T C 4: 150,282,598 (GRCm39) K16E probably benign Het
Cgnl1 C T 9: 71,563,378 (GRCm39) D779N probably benign Het
Cyp2a4 G A 7: 26,007,962 (GRCm39) R123Q possibly damaging Het
D430041D05Rik C T 2: 103,987,161 (GRCm39) R1895Q probably damaging Het
D5Ertd579e T A 5: 36,773,550 (GRCm39) T282S probably benign Het
Dsel T C 1: 111,787,692 (GRCm39) T948A probably benign Het
Ednrb A T 14: 104,080,536 (GRCm39) I126N probably damaging Het
Egln1 A G 8: 125,675,045 (GRCm39) M250T probably benign Het
Epb41l3 A T 17: 69,560,463 (GRCm39) I337L possibly damaging Het
Epg5 T C 18: 77,991,960 (GRCm39) I219T probably benign Het
Gm13030 T C 4: 138,600,730 (GRCm39) probably benign Het
Gm1527 T A 3: 28,980,810 (GRCm39) C637S probably benign Het
H1f1 A G 13: 23,947,932 (GRCm39) N78S possibly damaging Het
Insrr T C 3: 87,721,598 (GRCm39) I1168T possibly damaging Het
Ireb2 T C 9: 54,803,836 (GRCm39) V509A possibly damaging Het
Kmt2c T C 5: 25,559,715 (GRCm39) D981G probably damaging Het
L3hypdh A T 12: 72,126,301 (GRCm39) V213E probably damaging Het
Masp1 T G 16: 23,310,709 (GRCm39) D241A probably damaging Het
Mfsd13b A G 7: 120,591,047 (GRCm39) I1V probably null Het
Muc5b T C 7: 141,423,491 (GRCm39) V4531A probably benign Het
Myh2 A T 11: 67,065,767 (GRCm39) probably null Het
Naip5 A G 13: 100,358,041 (GRCm39) L1065P probably damaging Het
Necab1 T C 4: 15,140,219 (GRCm39) probably benign Het
Nemf A G 12: 69,400,560 (GRCm39) probably benign Het
Nfil3 A T 13: 53,122,069 (GRCm39) D278E possibly damaging Het
Nup98 T C 7: 101,829,631 (GRCm39) N393S probably damaging Het
Ogdh T A 11: 6,299,393 (GRCm39) M753K probably benign Het
Or13c3 T C 4: 52,855,568 (GRCm39) Y315C probably benign Het
Or2b6 A T 13: 21,823,606 (GRCm39) V29E probably damaging Het
Or4k47 C T 2: 111,452,084 (GRCm39) V112M probably benign Het
Or51f5 T C 7: 102,424,450 (GRCm39) F240L probably benign Het
Or8b42 T A 9: 38,342,378 (GRCm39) S267T probably benign Het
Pkd2 A G 5: 104,624,989 (GRCm39) K262E probably benign Het
Plce1 C T 19: 38,715,457 (GRCm39) probably benign Het
Ppm1f T A 16: 16,741,744 (GRCm39) M406K possibly damaging Het
Ptgs1 C T 2: 36,132,859 (GRCm39) Q286* probably null Het
Scube2 T C 7: 109,407,712 (GRCm39) T743A possibly damaging Het
Tipin T A 9: 64,197,658 (GRCm39) L69* probably null Het
Tlk1 T A 2: 70,568,789 (GRCm39) K404N probably damaging Het
Tmem59 C A 4: 107,035,971 (GRCm39) L16I probably damaging Het
Utrn T C 10: 12,612,826 (GRCm39) E426G probably benign Het
Xdh A T 17: 74,216,320 (GRCm39) S709T probably damaging Het
Yjefn3 T C 8: 70,342,137 (GRCm39) N28D probably damaging Het
Zfp598 A C 17: 24,898,641 (GRCm39) D480A probably damaging Het
Other mutations in Ktn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ktn1 APN 14 47,946,335 (GRCm39) missense probably benign 0.30
IGL01109:Ktn1 APN 14 47,952,178 (GRCm39) missense probably damaging 1.00
IGL02300:Ktn1 APN 14 47,927,517 (GRCm39) missense probably damaging 1.00
IGL02339:Ktn1 APN 14 47,920,835 (GRCm39) splice site probably benign
IGL02525:Ktn1 APN 14 47,962,200 (GRCm39) critical splice donor site probably null
IGL02565:Ktn1 APN 14 47,910,391 (GRCm39) splice site probably benign
IGL02678:Ktn1 APN 14 47,971,610 (GRCm39) critical splice acceptor site probably null
IGL03181:Ktn1 APN 14 47,970,741 (GRCm39) missense probably benign 0.19
IGL03393:Ktn1 APN 14 47,928,391 (GRCm39) missense probably damaging 1.00
PIT4520001:Ktn1 UTSW 14 47,923,774 (GRCm39) missense probably damaging 0.96
R0035:Ktn1 UTSW 14 47,967,836 (GRCm39) missense probably benign 0.07
R0035:Ktn1 UTSW 14 47,967,836 (GRCm39) missense probably benign 0.07
R0270:Ktn1 UTSW 14 47,952,119 (GRCm39) missense probably benign 0.00
R0370:Ktn1 UTSW 14 47,901,532 (GRCm39) missense probably benign 0.00
R0371:Ktn1 UTSW 14 47,961,460 (GRCm39) nonsense probably null
R0530:Ktn1 UTSW 14 47,970,700 (GRCm39) missense probably benign 0.14
R0531:Ktn1 UTSW 14 47,901,398 (GRCm39) missense probably damaging 0.98
R0611:Ktn1 UTSW 14 47,932,073 (GRCm39) missense probably benign
R0836:Ktn1 UTSW 14 47,938,519 (GRCm39) splice site probably null
R1076:Ktn1 UTSW 14 47,932,095 (GRCm39) missense probably damaging 0.99
R1522:Ktn1 UTSW 14 47,904,873 (GRCm39) missense probably damaging 1.00
R1554:Ktn1 UTSW 14 47,932,964 (GRCm39) missense probably damaging 1.00
R1992:Ktn1 UTSW 14 47,932,978 (GRCm39) missense probably damaging 1.00
R2040:Ktn1 UTSW 14 47,938,069 (GRCm39) splice site probably benign
R2110:Ktn1 UTSW 14 47,931,345 (GRCm39) missense possibly damaging 0.47
R2144:Ktn1 UTSW 14 47,952,109 (GRCm39) missense probably damaging 1.00
R3730:Ktn1 UTSW 14 47,938,606 (GRCm39) missense probably damaging 1.00
R3780:Ktn1 UTSW 14 47,943,860 (GRCm39) splice site probably benign
R3782:Ktn1 UTSW 14 47,943,860 (GRCm39) splice site probably benign
R4414:Ktn1 UTSW 14 47,962,387 (GRCm39) nonsense probably null
R4610:Ktn1 UTSW 14 47,963,636 (GRCm39) intron probably benign
R4784:Ktn1 UTSW 14 47,930,953 (GRCm39) critical splice donor site probably null
R4838:Ktn1 UTSW 14 47,963,413 (GRCm39) nonsense probably null
R4909:Ktn1 UTSW 14 47,943,917 (GRCm39) missense probably damaging 0.99
R4976:Ktn1 UTSW 14 47,907,756 (GRCm39) critical splice donor site probably null
R5110:Ktn1 UTSW 14 47,941,744 (GRCm39) splice site probably benign
R5257:Ktn1 UTSW 14 47,904,820 (GRCm39) missense probably benign 0.05
R5469:Ktn1 UTSW 14 47,928,377 (GRCm39) missense probably damaging 1.00
R5600:Ktn1 UTSW 14 47,927,490 (GRCm39) missense probably damaging 1.00
R5607:Ktn1 UTSW 14 47,971,554 (GRCm39) intron probably benign
R5608:Ktn1 UTSW 14 47,971,554 (GRCm39) intron probably benign
R5920:Ktn1 UTSW 14 47,961,481 (GRCm39) nonsense probably null
R6045:Ktn1 UTSW 14 47,914,253 (GRCm39) missense probably damaging 1.00
R6139:Ktn1 UTSW 14 47,963,672 (GRCm39) splice site probably null
R6282:Ktn1 UTSW 14 47,901,428 (GRCm39) missense probably damaging 1.00
R6654:Ktn1 UTSW 14 47,927,457 (GRCm39) missense probably damaging 1.00
R6957:Ktn1 UTSW 14 47,904,810 (GRCm39) nonsense probably null
R6959:Ktn1 UTSW 14 47,957,713 (GRCm39) missense probably damaging 1.00
R7170:Ktn1 UTSW 14 47,943,867 (GRCm39) missense probably damaging 1.00
R7206:Ktn1 UTSW 14 47,932,985 (GRCm39) missense probably damaging 0.97
R7442:Ktn1 UTSW 14 47,952,097 (GRCm39) missense probably benign 0.01
R7462:Ktn1 UTSW 14 47,932,089 (GRCm39) missense probably null 1.00
R7513:Ktn1 UTSW 14 47,901,541 (GRCm39) missense possibly damaging 0.77
R7743:Ktn1 UTSW 14 47,907,750 (GRCm39) missense probably damaging 1.00
R8010:Ktn1 UTSW 14 47,943,230 (GRCm39) missense possibly damaging 0.60
R8062:Ktn1 UTSW 14 47,962,429 (GRCm39) critical splice donor site probably null
R8244:Ktn1 UTSW 14 47,912,280 (GRCm39) missense probably null 1.00
R8387:Ktn1 UTSW 14 47,944,744 (GRCm39) splice site probably null
R8724:Ktn1 UTSW 14 47,931,335 (GRCm39) missense probably benign 0.00
R8725:Ktn1 UTSW 14 47,907,757 (GRCm39) critical splice donor site probably benign
R8962:Ktn1 UTSW 14 47,901,248 (GRCm39) missense probably damaging 1.00
R9001:Ktn1 UTSW 14 47,910,409 (GRCm39) missense probably damaging 0.99
R9072:Ktn1 UTSW 14 47,941,694 (GRCm39) missense probably benign 0.25
R9324:Ktn1 UTSW 14 47,948,353 (GRCm39) missense probably benign 0.02
R9423:Ktn1 UTSW 14 47,912,318 (GRCm39) missense probably benign 0.00
R9479:Ktn1 UTSW 14 47,962,174 (GRCm39) missense probably damaging 0.98
R9674:Ktn1 UTSW 14 47,922,213 (GRCm39) missense possibly damaging 0.77
R9718:Ktn1 UTSW 14 47,910,508 (GRCm39) missense probably damaging 0.98
Z1177:Ktn1 UTSW 14 47,929,895 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTAGAGATGAATATGGCCCAACC -3'
(R):5'- GCTGTCAACACAACAAAGGG -3'

Sequencing Primer
(F):5'- CCACTTATAGACCGTGCCATG -3'
(R):5'- GCAGTTAAGCCATTTACATTTTCC -3'
Posted On 2014-09-17