Incidental Mutation 'R2080:Epb41l3'
ID 229446
Institutional Source Beutler Lab
Gene Symbol Epb41l3
Ensembl Gene ENSMUSG00000024044
Gene Name erythrocyte membrane protein band 4.1 like 3
Synonyms DAL1P, NBL3, Epb4.1l3, 4.1B
MMRRC Submission 040085-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2080 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 69075683-69289989 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69253468 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 337 (I337L)
Ref Sequence ENSEMBL: ENSMUSP00000108300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080208] [ENSMUST00000112680] [ENSMUST00000225740] [ENSMUST00000225977]
AlphaFold Q9WV92
Predicted Effect possibly damaging
Transcript: ENSMUST00000080208
AA Change: I337L

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079098
Gene: ENSMUSG00000024044
AA Change: I337L

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
B41 114 309 1.13e-80 SMART
FERM_C 313 403 3.96e-38 SMART
FA 405 451 2.34e-17 SMART
low complexity region 497 517 N/A INTRINSIC
Pfam:SAB 556 604 2.1e-29 PFAM
low complexity region 789 802 N/A INTRINSIC
Pfam:4_1_CTD 809 922 1.9e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112680
AA Change: I337L

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108300
Gene: ENSMUSG00000024044
AA Change: I337L

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
B41 114 309 1.13e-80 SMART
FERM_C 313 403 3.96e-38 SMART
FA 405 451 2.34e-17 SMART
low complexity region 497 517 N/A INTRINSIC
Pfam:SAB 566 614 3.2e-28 PFAM
low complexity region 799 812 N/A INTRINSIC
Pfam:4_1_CTD 825 931 2.9e-55 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000223703
AA Change: I136L
Predicted Effect unknown
Transcript: ENSMUST00000224523
AA Change: I40L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225604
Predicted Effect probably benign
Transcript: ENSMUST00000225740
Predicted Effect probably benign
Transcript: ENSMUST00000225977
AA Change: I337L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.4122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele display a normal phenotype. Mice homozygous for a different knock-out allele exhibit ataxia, gait abnormalities, clasping, hypermyelination, abnormal axon morphology, and decreased internode length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tipin T A 9: 64,290,376 L69* probably null Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in Epb41l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Epb41l3 APN 17 69207861 splice site probably benign
IGL01099:Epb41l3 APN 17 69210193 missense possibly damaging 0.80
IGL01578:Epb41l3 APN 17 69248709 missense probably damaging 1.00
IGL02269:Epb41l3 APN 17 69247573 missense probably damaging 1.00
IGL02926:Epb41l3 APN 17 69247746 missense probably damaging 1.00
IGL03397:Epb41l3 APN 17 69248692 missense probably damaging 1.00
E0370:Epb41l3 UTSW 17 69274804 missense possibly damaging 0.73
P0031:Epb41l3 UTSW 17 69259054 nonsense probably null
R0032:Epb41l3 UTSW 17 69210384 critical splice donor site probably null
R0056:Epb41l3 UTSW 17 69253397 missense probably damaging 1.00
R0092:Epb41l3 UTSW 17 69286750 missense probably damaging 1.00
R0499:Epb41l3 UTSW 17 69247659 missense probably benign 0.00
R0560:Epb41l3 UTSW 17 69274897 critical splice donor site probably null
R1164:Epb41l3 UTSW 17 69274767 missense possibly damaging 0.93
R1170:Epb41l3 UTSW 17 69259180 nonsense probably null
R1397:Epb41l3 UTSW 17 69262348 critical splice donor site probably null
R2138:Epb41l3 UTSW 17 69207880 missense probably damaging 1.00
R2279:Epb41l3 UTSW 17 69270650 missense possibly damaging 0.56
R2863:Epb41l3 UTSW 17 69210321 missense probably benign 0.22
R3883:Epb41l3 UTSW 17 69274116 nonsense probably null
R3884:Epb41l3 UTSW 17 69274116 nonsense probably null
R4165:Epb41l3 UTSW 17 69207888 missense probably damaging 1.00
R4795:Epb41l3 UTSW 17 69248719 critical splice donor site probably null
R5286:Epb41l3 UTSW 17 69262273 missense probably benign 0.00
R5303:Epb41l3 UTSW 17 69257449 missense probably damaging 1.00
R5373:Epb41l3 UTSW 17 69286800 missense probably damaging 1.00
R5374:Epb41l3 UTSW 17 69286800 missense probably damaging 1.00
R5938:Epb41l3 UTSW 17 69259071 missense probably damaging 1.00
R6014:Epb41l3 UTSW 17 69283960 missense probably damaging 0.98
R6059:Epb41l3 UTSW 17 69284642 missense probably damaging 1.00
R6059:Epb41l3 UTSW 17 69286798 missense probably damaging 1.00
R7318:Epb41l3 UTSW 17 69266140 missense
R7480:Epb41l3 UTSW 17 69261872 splice site probably null
R7548:Epb41l3 UTSW 17 69210276 missense probably damaging 1.00
R7719:Epb41l3 UTSW 17 69253414 missense possibly damaging 0.81
R7769:Epb41l3 UTSW 17 69238426 missense probably damaging 0.98
R7903:Epb41l3 UTSW 17 69274337 splice site probably null
R8099:Epb41l3 UTSW 17 69247688 missense possibly damaging 0.79
R8175:Epb41l3 UTSW 17 69210366 missense probably damaging 1.00
R8225:Epb41l3 UTSW 17 69274801 missense possibly damaging 0.52
R8364:Epb41l3 UTSW 17 69266434 critical splice donor site probably null
R8540:Epb41l3 UTSW 17 69286762 missense probably damaging 1.00
R8859:Epb41l3 UTSW 17 69284580 missense probably benign 0.28
R8984:Epb41l3 UTSW 17 69247646 missense probably damaging 1.00
R9048:Epb41l3 UTSW 17 69210223 missense probably benign 0.06
X0066:Epb41l3 UTSW 17 69259158 nonsense probably null
Z1088:Epb41l3 UTSW 17 69253522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGCTATTATGTGGTAGTGGCGC -3'
(R):5'- CCACAGTGCTTGGAATTCTCC -3'

Sequencing Primer
(F):5'- TGGCGCTTTAAAAACTGCAGC -3'
(R):5'- CCAACACATGGTTTATATTTCCGC -3'
Posted On 2014-09-17