Incidental Mutation 'R2081:Camta1'
ID229471
Institutional Source Beutler Lab
Gene Symbol Camta1
Ensembl Gene ENSMUSG00000014592
Gene Namecalmodulin binding transcription activator 1
Synonyms1810059M14Rik, 2310058O09Rik
MMRRC Submission 040086-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock #R2081 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location150917322-151861876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151144242 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 711 (E711G)
Ref Sequence ENSEMBL: ENSMUSP00000127916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049790] [ENSMUST00000097774] [ENSMUST00000169423]
Predicted Effect probably benign
Transcript: ENSMUST00000049790
AA Change: E711G

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054804
Gene: ENSMUSG00000014592
AA Change: E711G

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3e-13 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097774
AA Change: E711G

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095381
Gene: ENSMUSG00000014592
AA Change: E711G

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1570 5.45e1 SMART
IQ 1571 1593 5.42e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143434
Predicted Effect probably benign
Transcript: ENSMUST00000169423
AA Change: E711G

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592
AA Change: E711G

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Global or nervous system deletion of this gene results in decreased body size, severe ataxia, progressive Purkinje cell degeneration, and cerebellar atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,320,259 T28A possibly damaging Het
Actl11 G A 9: 107,930,197 G573D probably benign Het
Adam39 T A 8: 40,826,842 *757K probably null Het
Agpat4 T C 17: 12,151,884 I38T possibly damaging Het
Akap2 G A 4: 57,855,927 E419K possibly damaging Het
Ap3d1 A C 10: 80,732,936 I36S probably damaging Het
Arhgap45 T C 10: 80,027,674 F784L probably damaging Het
Atp10b T A 11: 43,202,128 I430N probably damaging Het
Atrip T A 9: 109,072,739 probably null Het
C2cd4b G T 9: 67,760,577 R285L probably damaging Het
Clcn6 T C 4: 148,011,068 Y685C probably damaging Het
Col18a1 T A 10: 77,054,185 D1447V probably damaging Het
Crispld1 T A 1: 17,762,179 V463D probably damaging Het
Crybg2 T G 4: 134,088,820 F1612V possibly damaging Het
Dclk1 T C 3: 55,521,925 probably null Het
Ddx46 G T 13: 55,674,016 V834L probably benign Het
Dnah10 A G 5: 124,774,981 D1734G possibly damaging Het
Dpep1 T C 8: 123,199,378 V152A probably damaging Het
Ect2l T C 10: 18,165,527 E301G probably damaging Het
Elf3 C T 1: 135,257,076 C124Y probably benign Het
Eno2 A G 6: 124,763,125 V316A probably damaging Het
Erap1 A G 13: 74,675,307 E820G possibly damaging Het
Evpl A T 11: 116,234,266 H123Q probably damaging Het
Fat2 T A 11: 55,309,677 Y857F possibly damaging Het
Fbrsl1 T A 5: 110,371,625 probably null Het
Fbxw7 A G 3: 84,974,513 D432G probably damaging Het
Flt1 A T 5: 147,639,422 L592Q probably damaging Het
Gm14496 T A 2: 182,000,479 C648S probably damaging Het
Gm5150 A T 3: 15,990,945 S39T probably benign Het
Gm5426 T C 10: 96,136,739 I46T possibly damaging Het
Gse1 C A 8: 120,566,480 P177Q probably damaging Het
Heatr4 G A 12: 83,980,322 R54W probably damaging Het
Hpgd C A 8: 56,307,642 Q125K probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Mast2 A T 4: 116,330,474 probably null Het
Mfsd11 A G 11: 116,861,555 T177A possibly damaging Het
Mlx T C 11: 101,087,431 S36P probably benign Het
Mlxipl T A 5: 135,113,638 V102D probably damaging Het
Mms22l T C 4: 24,536,150 Y540H probably damaging Het
Msc T C 1: 14,755,717 D11G probably benign Het
Muc4 C G 16: 32,752,220 S699R probably benign Het
Nckap1l T C 15: 103,497,454 S1106P probably damaging Het
Obscn T C 11: 59,034,182 E5703G possibly damaging Het
Olfr705 A G 7: 106,714,198 M161T probably benign Het
Pabpn1 A G 14: 54,895,658 K38E probably damaging Het
Padi3 A T 4: 140,798,979 L141Q probably damaging Het
Pde3b A G 7: 114,523,422 N742D probably benign Het
Pex1 T A 5: 3,624,132 probably null Het
Pkd2 T C 5: 104,460,211 V192A probably benign Het
Ppp6r2 T A 15: 89,282,129 M750K probably benign Het
Prdm15 A T 16: 97,803,780 Y783* probably null Het
Prox2 T A 12: 85,095,008 Q140H probably damaging Het
Psg27 A T 7: 18,556,958 I440K probably damaging Het
Pzp A G 6: 128,519,420 M283T probably benign Het
Sec23a G A 12: 58,998,281 Q192* probably null Het
Sh2b1 A G 7: 126,472,690 S108P possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tkfc G A 19: 10,597,378 A166V probably damaging Het
Tomm70a T C 16: 57,140,758 V358A probably damaging Het
Trim47 A G 11: 116,106,413 F505S probably damaging Het
Tti2 T C 8: 31,151,309 F154L possibly damaging Het
Ubap2l C T 3: 90,038,964 G111D possibly damaging Het
Usp9y A T Y: 1,381,277 I848N possibly damaging Het
Veph1 T C 3: 66,061,102 Y740C probably damaging Het
Vmn2r114 T A 17: 23,291,109 H799L possibly damaging Het
Wdr31 T A 4: 62,455,943 M270L probably benign Het
Zfp26 A G 9: 20,436,617 S884P probably benign Het
Zswim6 T A 13: 107,773,395 noncoding transcript Het
Other mutations in Camta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Camta1 APN 4 151071424 critical splice donor site probably null
IGL00823:Camta1 APN 4 151084601 missense probably benign 0.02
IGL01361:Camta1 APN 4 151144692 missense probably damaging 1.00
IGL01523:Camta1 APN 4 151145050 missense possibly damaging 0.73
IGL01730:Camta1 APN 4 151062845 missense probably damaging 0.99
IGL02045:Camta1 APN 4 151073985 splice site probably null
IGL02541:Camta1 APN 4 151084655 missense probably benign 0.12
IGL02839:Camta1 APN 4 151144512 missense probably damaging 1.00
IGL03012:Camta1 APN 4 151453299 missense probably damaging 1.00
Bonus UTSW 4 151138375 missense probably damaging 1.00
PIT4449001:Camta1 UTSW 4 151131586 missense probably benign 0.00
R0136:Camta1 UTSW 4 151078969 missense probably damaging 0.99
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0276:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0346:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0347:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0348:Camta1 UTSW 4 151586431 missense possibly damaging 0.64
R0385:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0386:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0388:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0410:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0456:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0478:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0510:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0511:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0683:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0724:Camta1 UTSW 4 151077892 missense probably damaging 1.00
R0732:Camta1 UTSW 4 151586484 critical splice acceptor site probably null
R1549:Camta1 UTSW 4 151586463 missense probably damaging 1.00
R1670:Camta1 UTSW 4 151079771 missense probably benign 0.00
R1704:Camta1 UTSW 4 151075224 missense probably damaging 1.00
R1718:Camta1 UTSW 4 151084024 missense probably benign 0.00
R1941:Camta1 UTSW 4 151075155 missense probably damaging 1.00
R1967:Camta1 UTSW 4 151088973 missense probably damaging 0.99
R1998:Camta1 UTSW 4 151077880 missense probably damaging 1.00
R2104:Camta1 UTSW 4 151453294 missense probably damaging 0.99
R2240:Camta1 UTSW 4 151084575 missense possibly damaging 0.66
R4516:Camta1 UTSW 4 151144720 missense possibly damaging 0.90
R4539:Camta1 UTSW 4 151084812 missense probably benign 0.03
R4552:Camta1 UTSW 4 151792502 missense probably damaging 0.96
R4610:Camta1 UTSW 4 151084827 missense probably damaging 1.00
R4658:Camta1 UTSW 4 151143910 missense probably damaging 1.00
R4725:Camta1 UTSW 4 151148496 missense probably benign 0.11
R4786:Camta1 UTSW 4 151290039 missense probably damaging 1.00
R4812:Camta1 UTSW 4 151131542 missense probably null 0.25
R4840:Camta1 UTSW 4 151144407 missense probably benign 0.23
R5038:Camta1 UTSW 4 151145469 missense probably damaging 1.00
R5112:Camta1 UTSW 4 151074054 missense probably damaging 1.00
R5251:Camta1 UTSW 4 151163884 missense probably damaging 1.00
R5388:Camta1 UTSW 4 151075238 missense probably damaging 1.00
R5487:Camta1 UTSW 4 151144754 missense possibly damaging 0.73
R6343:Camta1 UTSW 4 151079849 missense probably damaging 0.98
R6462:Camta1 UTSW 4 151086164 missense probably damaging 0.98
R6550:Camta1 UTSW 4 151138375 missense probably damaging 1.00
R6990:Camta1 UTSW 4 151145044 missense probably damaging 0.97
R7165:Camta1 UTSW 4 151084700 missense possibly damaging 0.63
R7190:Camta1 UTSW 4 151148523 missense possibly damaging 0.57
R7215:Camta1 UTSW 4 151144737 missense probably damaging 1.00
R7264:Camta1 UTSW 4 151453399 missense probably damaging 1.00
R7403:Camta1 UTSW 4 151453295 nonsense probably null
R7445:Camta1 UTSW 4 151144291 missense possibly damaging 0.94
R7447:Camta1 UTSW 4 151083870 missense probably benign 0.31
R7585:Camta1 UTSW 4 151144830 missense probably damaging 1.00
R7881:Camta1 UTSW 4 151835876 missense probably damaging 0.99
R7964:Camta1 UTSW 4 151835876 missense probably damaging 0.99
R8057:Camta1 UTSW 4 151144032 missense probably damaging 1.00
R8073:Camta1 UTSW 4 151078824 missense probably damaging 1.00
X0063:Camta1 UTSW 4 151145247 missense probably damaging 1.00
Z1176:Camta1 UTSW 4 151144385 missense probably benign 0.06
Z1177:Camta1 UTSW 4 151077925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCTGAGAACTGATTGCTG -3'
(R):5'- TGATGCCCACGGTGAAAACG -3'

Sequencing Primer
(F):5'- AACTGATTGCTGAAGGAAATGTC -3'
(R):5'- TGAAAACGGAGGCCTCGTC -3'
Posted On2014-09-17