Incidental Mutation 'R2081:Hsh2d'
ID229490
Institutional Source Beutler Lab
Gene Symbol Hsh2d
Ensembl Gene ENSMUSG00000062007
Gene Namehematopoietic SH2 domain containing
SynonymsALX, Hsh2
MMRRC Submission 040086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R2081 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72189638-72201527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72200460 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 229 (D229N)
Ref Sequence ENSEMBL: ENSMUSP00000127575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072097] [ENSMUST00000098630] [ENSMUST00000165324]
Predicted Effect probably benign
Transcript: ENSMUST00000072097
AA Change: D229N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071970
Gene: ENSMUSG00000062007
AA Change: D229N

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098630
SMART Domains Protein: ENSMUSP00000096231
Gene: ENSMUSG00000074240

DomainStartEndE-ValueType
EFh 43 71 3.97e1 SMART
EFh 80 108 4.32e1 SMART
EFh 121 149 1.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165324
AA Change: D229N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127575
Gene: ENSMUSG00000062007
AA Change: D229N

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211946
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] T-cell activation requires 2 signals: recognition of antigen by the T-cell receptor (see TCR; MIM 186880) and a costimulatory signal provided primarily by CD28 (MIM 186760) in naive T cells. HSH2 is a target of both of these signaling pathways (Greene et al., 2003 [PubMed 12960172]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced IL-2 production, increased T cell proliferation in response to TCR/CD28 stimulation, splenomegaly, and an increased frequency of activated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,320,259 T28A possibly damaging Het
Actl11 G A 9: 107,930,197 G573D probably benign Het
Adam39 T A 8: 40,826,842 *757K probably null Het
Agpat4 T C 17: 12,151,884 I38T possibly damaging Het
Akap2 G A 4: 57,855,927 E419K possibly damaging Het
Ap3d1 A C 10: 80,732,936 I36S probably damaging Het
Arhgap45 T C 10: 80,027,674 F784L probably damaging Het
Atp10b T A 11: 43,202,128 I430N probably damaging Het
Atrip T A 9: 109,072,739 probably null Het
C2cd4b G T 9: 67,760,577 R285L probably damaging Het
Camta1 T C 4: 151,144,242 E711G probably benign Het
Clcn6 T C 4: 148,011,068 Y685C probably damaging Het
Col18a1 T A 10: 77,054,185 D1447V probably damaging Het
Crispld1 T A 1: 17,762,179 V463D probably damaging Het
Crybg2 T G 4: 134,088,820 F1612V possibly damaging Het
Dclk1 T C 3: 55,521,925 probably null Het
Ddx46 G T 13: 55,674,016 V834L probably benign Het
Dnah10 A G 5: 124,774,981 D1734G possibly damaging Het
Dpep1 T C 8: 123,199,378 V152A probably damaging Het
Ect2l T C 10: 18,165,527 E301G probably damaging Het
Elf3 C T 1: 135,257,076 C124Y probably benign Het
Eno2 A G 6: 124,763,125 V316A probably damaging Het
Erap1 A G 13: 74,675,307 E820G possibly damaging Het
Evpl A T 11: 116,234,266 H123Q probably damaging Het
Fat2 T A 11: 55,309,677 Y857F possibly damaging Het
Fbrsl1 T A 5: 110,371,625 probably null Het
Fbxw7 A G 3: 84,974,513 D432G probably damaging Het
Flt1 A T 5: 147,639,422 L592Q probably damaging Het
Gm14496 T A 2: 182,000,479 C648S probably damaging Het
Gm5150 A T 3: 15,990,945 S39T probably benign Het
Gm5426 T C 10: 96,136,739 I46T possibly damaging Het
Gse1 C A 8: 120,566,480 P177Q probably damaging Het
Heatr4 G A 12: 83,980,322 R54W probably damaging Het
Hpgd C A 8: 56,307,642 Q125K probably benign Het
Mast2 A T 4: 116,330,474 probably null Het
Mfsd11 A G 11: 116,861,555 T177A possibly damaging Het
Mlx T C 11: 101,087,431 S36P probably benign Het
Mlxipl T A 5: 135,113,638 V102D probably damaging Het
Mms22l T C 4: 24,536,150 Y540H probably damaging Het
Msc T C 1: 14,755,717 D11G probably benign Het
Muc4 C G 16: 32,752,220 S699R probably benign Het
Nckap1l T C 15: 103,497,454 S1106P probably damaging Het
Obscn T C 11: 59,034,182 E5703G possibly damaging Het
Olfr705 A G 7: 106,714,198 M161T probably benign Het
Pabpn1 A G 14: 54,895,658 K38E probably damaging Het
Padi3 A T 4: 140,798,979 L141Q probably damaging Het
Pde3b A G 7: 114,523,422 N742D probably benign Het
Pex1 T A 5: 3,624,132 probably null Het
Pkd2 T C 5: 104,460,211 V192A probably benign Het
Ppp6r2 T A 15: 89,282,129 M750K probably benign Het
Prdm15 A T 16: 97,803,780 Y783* probably null Het
Prox2 T A 12: 85,095,008 Q140H probably damaging Het
Psg27 A T 7: 18,556,958 I440K probably damaging Het
Pzp A G 6: 128,519,420 M283T probably benign Het
Sec23a G A 12: 58,998,281 Q192* probably null Het
Sh2b1 A G 7: 126,472,690 S108P possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tkfc G A 19: 10,597,378 A166V probably damaging Het
Tomm70a T C 16: 57,140,758 V358A probably damaging Het
Trim47 A G 11: 116,106,413 F505S probably damaging Het
Tti2 T C 8: 31,151,309 F154L possibly damaging Het
Ubap2l C T 3: 90,038,964 G111D possibly damaging Het
Usp9y A T Y: 1,381,277 I848N possibly damaging Het
Veph1 T C 3: 66,061,102 Y740C probably damaging Het
Vmn2r114 T A 17: 23,291,109 H799L possibly damaging Het
Wdr31 T A 4: 62,455,943 M270L probably benign Het
Zfp26 A G 9: 20,436,617 S884P probably benign Het
Zswim6 T A 13: 107,773,395 noncoding transcript Het
Other mutations in Hsh2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Hsh2d APN 8 72200619 missense probably damaging 0.98
IGL01134:Hsh2d APN 8 72193531 missense probably damaging 0.96
IGL01778:Hsh2d APN 8 72193507 missense probably damaging 1.00
IGL03324:Hsh2d APN 8 72193512 missense probably damaging 1.00
R0002:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0064:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0309:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0312:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0369:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0449:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0450:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0481:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0483:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0554:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0704:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0843:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0947:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0948:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0966:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0967:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1051:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1055:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1076:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1105:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1108:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1144:Hsh2d UTSW 8 72193592 splice site probably benign
R1150:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1186:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1345:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1371:Hsh2d UTSW 8 72196894 splice site probably benign
R1400:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1419:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1430:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1514:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1551:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1691:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1857:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1859:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1914:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1915:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1982:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2050:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2105:Hsh2d UTSW 8 72200646 missense probably benign
R4077:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4078:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4823:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4824:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4903:Hsh2d UTSW 8 72193528 missense probably benign
R4966:Hsh2d UTSW 8 72193528 missense probably benign
R6550:Hsh2d UTSW 8 72198453 missense probably benign
R7418:Hsh2d UTSW 8 72196794 critical splice acceptor site probably null
R7673:Hsh2d UTSW 8 72200511 missense probably benign 0.15
R7911:Hsh2d UTSW 8 72196804 missense probably damaging 1.00
R7992:Hsh2d UTSW 8 72196804 missense probably damaging 1.00
Y4335:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4336:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4337:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4338:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATCTCTGTTCCAGGCTTCTGAAAG -3'
(R):5'- AGGCTTTGACCCCTGAGAATG -3'

Sequencing Primer
(F):5'- ACTGTGGAAGAACCTGAG -3'
(R):5'- GAGAATGCCTTCCTCCAGCTG -3'
Posted On2014-09-17