Incidental Mutation 'R2081:Zfp26'
ID229494
Institutional Source Beutler Lab
Gene Symbol Zfp26
Ensembl Gene ENSMUSG00000063108
Gene Namezinc finger protein 26
SynonymsZfp70, KRAB15, Zfp81-rs1, Zfp-26, 5033428C05Rik, mkr-3
MMRRC Submission 040086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2081 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20428449-20460162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20436617 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 884 (S884P)
Ref Sequence ENSEMBL: ENSMUSP00000124075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159569]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098970
Predicted Effect probably benign
Transcript: ENSMUST00000159569
AA Change: S884P

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124075
Gene: ENSMUSG00000063108
AA Change: S884P

DomainStartEndE-ValueType
Blast:KRAB 40 93 3e-6 BLAST
KRAB 107 167 4.28e-32 SMART
ZnF_C2H2 289 311 3.34e-2 SMART
ZnF_C2H2 344 366 3.63e-3 SMART
ZnF_C2H2 372 394 4.54e-4 SMART
ZnF_C2H2 400 422 2.65e-5 SMART
ZnF_C2H2 428 450 1.12e-3 SMART
ZnF_C2H2 456 478 9.08e-4 SMART
ZnF_C2H2 484 506 7.9e-4 SMART
ZnF_C2H2 512 534 2.43e-4 SMART
ZnF_C2H2 540 562 1.36e-2 SMART
ZnF_C2H2 568 590 3.44e-4 SMART
ZnF_C2H2 596 618 6.52e-5 SMART
ZnF_C2H2 624 646 2.32e-1 SMART
ZnF_C2H2 652 674 9.22e-5 SMART
ZnF_C2H2 680 702 1.22e-4 SMART
ZnF_C2H2 708 730 4.87e-4 SMART
ZnF_C2H2 736 758 4.54e-4 SMART
ZnF_C2H2 764 786 3.44e-4 SMART
ZnF_C2H2 792 814 5.21e-4 SMART
ZnF_C2H2 820 842 3.44e-4 SMART
ZnF_C2H2 848 870 5.14e-3 SMART
ZnF_C2H2 876 898 2.79e-4 SMART
ZnF_C2H2 904 926 2.12e-4 SMART
ZnF_C2H2 932 954 9.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180846
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the krueppel C2H2-type zinc-finger protein family, and it contains one KRAB domain and eighteen C2H2-type zinc fingers. This gene is a candidate gene for autism and variable cognitive impairment in the 16q24.3 microdeletion syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,320,259 T28A possibly damaging Het
Actl11 G A 9: 107,930,197 G573D probably benign Het
Adam39 T A 8: 40,826,842 *757K probably null Het
Agpat4 T C 17: 12,151,884 I38T possibly damaging Het
Akap2 G A 4: 57,855,927 E419K possibly damaging Het
Ap3d1 A C 10: 80,732,936 I36S probably damaging Het
Arhgap45 T C 10: 80,027,674 F784L probably damaging Het
Atp10b T A 11: 43,202,128 I430N probably damaging Het
Atrip T A 9: 109,072,739 probably null Het
C2cd4b G T 9: 67,760,577 R285L probably damaging Het
Camta1 T C 4: 151,144,242 E711G probably benign Het
Clcn6 T C 4: 148,011,068 Y685C probably damaging Het
Col18a1 T A 10: 77,054,185 D1447V probably damaging Het
Crispld1 T A 1: 17,762,179 V463D probably damaging Het
Crybg2 T G 4: 134,088,820 F1612V possibly damaging Het
Dclk1 T C 3: 55,521,925 probably null Het
Ddx46 G T 13: 55,674,016 V834L probably benign Het
Dnah10 A G 5: 124,774,981 D1734G possibly damaging Het
Dpep1 T C 8: 123,199,378 V152A probably damaging Het
Ect2l T C 10: 18,165,527 E301G probably damaging Het
Elf3 C T 1: 135,257,076 C124Y probably benign Het
Eno2 A G 6: 124,763,125 V316A probably damaging Het
Erap1 A G 13: 74,675,307 E820G possibly damaging Het
Evpl A T 11: 116,234,266 H123Q probably damaging Het
Fat2 T A 11: 55,309,677 Y857F possibly damaging Het
Fbrsl1 T A 5: 110,371,625 probably null Het
Fbxw7 A G 3: 84,974,513 D432G probably damaging Het
Flt1 A T 5: 147,639,422 L592Q probably damaging Het
Gm14496 T A 2: 182,000,479 C648S probably damaging Het
Gm5150 A T 3: 15,990,945 S39T probably benign Het
Gm5426 T C 10: 96,136,739 I46T possibly damaging Het
Gse1 C A 8: 120,566,480 P177Q probably damaging Het
Heatr4 G A 12: 83,980,322 R54W probably damaging Het
Hpgd C A 8: 56,307,642 Q125K probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Mast2 A T 4: 116,330,474 probably null Het
Mfsd11 A G 11: 116,861,555 T177A possibly damaging Het
Mlx T C 11: 101,087,431 S36P probably benign Het
Mlxipl T A 5: 135,113,638 V102D probably damaging Het
Mms22l T C 4: 24,536,150 Y540H probably damaging Het
Msc T C 1: 14,755,717 D11G probably benign Het
Muc4 C G 16: 32,752,220 S699R probably benign Het
Nckap1l T C 15: 103,497,454 S1106P probably damaging Het
Obscn T C 11: 59,034,182 E5703G possibly damaging Het
Olfr705 A G 7: 106,714,198 M161T probably benign Het
Pabpn1 A G 14: 54,895,658 K38E probably damaging Het
Padi3 A T 4: 140,798,979 L141Q probably damaging Het
Pde3b A G 7: 114,523,422 N742D probably benign Het
Pex1 T A 5: 3,624,132 probably null Het
Pkd2 T C 5: 104,460,211 V192A probably benign Het
Ppp6r2 T A 15: 89,282,129 M750K probably benign Het
Prdm15 A T 16: 97,803,780 Y783* probably null Het
Prox2 T A 12: 85,095,008 Q140H probably damaging Het
Psg27 A T 7: 18,556,958 I440K probably damaging Het
Pzp A G 6: 128,519,420 M283T probably benign Het
Sec23a G A 12: 58,998,281 Q192* probably null Het
Sh2b1 A G 7: 126,472,690 S108P possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tkfc G A 19: 10,597,378 A166V probably damaging Het
Tomm70a T C 16: 57,140,758 V358A probably damaging Het
Trim47 A G 11: 116,106,413 F505S probably damaging Het
Tti2 T C 8: 31,151,309 F154L possibly damaging Het
Ubap2l C T 3: 90,038,964 G111D possibly damaging Het
Usp9y A T Y: 1,381,277 I848N possibly damaging Het
Veph1 T C 3: 66,061,102 Y740C probably damaging Het
Vmn2r114 T A 17: 23,291,109 H799L possibly damaging Het
Wdr31 T A 4: 62,455,943 M270L probably benign Het
Zswim6 T A 13: 107,773,395 noncoding transcript Het
Other mutations in Zfp26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Zfp26 APN 9 20439548 missense possibly damaging 0.68
IGL02273:Zfp26 APN 9 20441448 missense probably damaging 0.96
FR4449:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4548:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4737:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4976:Zfp26 UTSW 9 20438546 missense probably benign 0.01
LCD18:Zfp26 UTSW 9 20438546 missense probably benign 0.01
R0157:Zfp26 UTSW 9 20437870 missense probably benign 0.37
R1591:Zfp26 UTSW 9 20437625 missense probably benign 0.01
R1818:Zfp26 UTSW 9 20442191 missense probably benign 0.00
R1936:Zfp26 UTSW 9 20437553 missense probably benign 0.04
R2107:Zfp26 UTSW 9 20442237 missense probably benign
R2240:Zfp26 UTSW 9 20437267 missense probably damaging 1.00
R3429:Zfp26 UTSW 9 20441460 unclassified probably benign
R3785:Zfp26 UTSW 9 20437802 missense probably damaging 1.00
R4050:Zfp26 UTSW 9 20442229 missense probably benign
R4198:Zfp26 UTSW 9 20436716 missense probably benign 0.17
R4200:Zfp26 UTSW 9 20436716 missense probably benign 0.17
R4360:Zfp26 UTSW 9 20438573 missense probably benign 0.35
R4505:Zfp26 UTSW 9 20442265 missense probably benign 0.29
R5171:Zfp26 UTSW 9 20444907 missense probably benign
R5412:Zfp26 UTSW 9 20438239 missense possibly damaging 0.75
R5493:Zfp26 UTSW 9 20444319 missense possibly damaging 0.66
R5576:Zfp26 UTSW 9 20437507 missense possibly damaging 0.86
R5652:Zfp26 UTSW 9 20437841 nonsense probably null
R6089:Zfp26 UTSW 9 20437693 missense probably damaging 0.99
R6332:Zfp26 UTSW 9 20437286 missense probably damaging 1.00
R7599:Zfp26 UTSW 9 20437833 missense probably damaging 1.00
R7713:Zfp26 UTSW 9 20441334 missense probably benign 0.08
X0065:Zfp26 UTSW 9 20436891 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAGAAGTAGTGAAGTTTTCCC -3'
(R):5'- GAAACTCTTCATCCCTTGAGACC -3'

Sequencing Primer
(F):5'- GAAGTAGTGAAGTTTTCCCCACATTC -3'
(R):5'- TTTACGCAATCACACTGGGG -3'
Posted On2014-09-17