Incidental Mutation 'R0158:Itih5'
ID 22950
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha-trypsin inhibitor, heavy chain 5
Synonyms 4631408O11Rik, 5430408M01Rik
MMRRC Submission 038438-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R0158 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 10158382-10261340 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 10239803 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably benign
Transcript: ENSMUST00000026886
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 93% (79/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,371,316 (GRCm39) R437C probably damaging Het
Abhd3 A G 18: 10,647,840 (GRCm39) Y315H possibly damaging Het
Adam19 C T 11: 46,033,861 (GRCm39) P891L probably damaging Het
Ampd1 T A 3: 102,999,046 (GRCm39) Y400* probably null Het
Ap1g1 T C 8: 110,582,267 (GRCm39) S724P probably benign Het
Bst2 T A 8: 71,989,861 (GRCm39) T71S possibly damaging Het
C3 A G 17: 57,531,851 (GRCm39) probably null Het
Cacna2d1 C A 5: 16,566,815 (GRCm39) probably benign Het
Cacna2d4 C T 6: 119,213,709 (GRCm39) H43Y possibly damaging Het
Ccdc71 T G 9: 108,341,336 (GRCm39) V383G probably benign Het
Cd109 A T 9: 78,596,214 (GRCm39) Q849L possibly damaging Het
Cdkn2a A T 4: 89,195,004 (GRCm39) H115Q possibly damaging Het
Ces1e T C 8: 93,946,057 (GRCm39) E161G probably benign Het
Cggbp1 C T 16: 64,676,201 (GRCm39) S89L possibly damaging Het
Crocc A T 4: 140,769,553 (GRCm39) probably benign Het
Cspg4b T A 13: 113,505,687 (GRCm39) L2272* probably null Het
Eef1akmt3 G A 10: 126,869,142 (GRCm39) Q111* probably null Het
Exoc7 T C 11: 116,186,118 (GRCm39) N361S probably benign Het
Fat2 G T 11: 55,187,011 (GRCm39) S1278R probably benign Het
Fbxo42 A G 4: 140,927,640 (GRCm39) N640S probably benign Het
Fbxw25 A G 9: 109,483,720 (GRCm39) V164A possibly damaging Het
Fcgbpl1 A G 7: 27,854,917 (GRCm39) I1848V probably damaging Het
Foxs1 T C 2: 152,774,330 (GRCm39) E241G probably damaging Het
Fras1 A T 5: 96,924,493 (GRCm39) I3645F possibly damaging Het
Gm14496 T A 2: 181,639,206 (GRCm39) V432E probably benign Het
H3c2 T A 13: 23,936,693 (GRCm39) C111S probably damaging Het
Herc1 T A 9: 66,403,203 (GRCm39) L4374* probably null Het
Ift122 T C 6: 115,901,445 (GRCm39) probably benign Het
Itgav C A 2: 83,622,381 (GRCm39) N654K probably benign Het
Jak2 C A 19: 29,289,157 (GRCm39) T1103K probably benign Het
Kcnc4 C A 3: 107,365,920 (GRCm39) C96F probably benign Het
Med13l C A 5: 118,880,514 (GRCm39) S1202Y unknown Het
Mefv T C 16: 3,533,320 (GRCm39) E317G possibly damaging Het
Ncoa2 T C 1: 13,222,608 (GRCm39) T1226A probably benign Het
Nktr C T 9: 121,579,757 (GRCm39) probably benign Het
Nudt5 G A 2: 5,867,114 (GRCm39) V61M probably damaging Het
Or51a39 C T 7: 102,363,162 (GRCm39) A153T probably benign Het
Pakap A G 4: 57,709,649 (GRCm39) D198G possibly damaging Het
Pcdhb2 A C 18: 37,430,283 (GRCm39) Y752S probably damaging Het
Pcnx4 A G 12: 72,603,076 (GRCm39) D446G probably benign Het
Pnp2 G A 14: 51,201,761 (GRCm39) R249H probably damaging Het
Rgs3 A T 4: 62,542,121 (GRCm39) I32F probably damaging Het
Rnf139 A G 15: 58,770,727 (GRCm39) T251A probably benign Het
Rnf41 A G 10: 128,274,104 (GRCm39) E252G probably damaging Het
Rxfp2 T A 5: 149,975,093 (GRCm39) F220Y probably benign Het
Sdcbp A G 4: 6,379,042 (GRCm39) D43G possibly damaging Het
Serpina3f A G 12: 104,183,267 (GRCm39) D43G probably damaging Het
Sftpc T C 14: 70,758,887 (GRCm39) K154R probably null Het
Simc1 A G 13: 54,672,530 (GRCm39) T293A probably benign Het
Skint6 A T 4: 113,042,011 (GRCm39) probably benign Het
Slc6a15 T C 10: 103,225,208 (GRCm39) probably benign Het
Spata31e2 T G 1: 26,723,032 (GRCm39) H716P probably damaging Het
Ston2 A T 12: 91,707,376 (GRCm39) I78N probably damaging Het
Taok3 T C 5: 117,355,307 (GRCm39) probably null Het
Tent4b G A 8: 88,977,371 (GRCm39) G391D probably damaging Het
Tiam1 C T 16: 89,589,889 (GRCm39) probably benign Het
Tnfsf15 T C 4: 63,648,229 (GRCm39) H137R possibly damaging Het
Tpte G A 8: 22,817,755 (GRCm39) R247H possibly damaging Het
Trim2 T C 3: 84,117,476 (GRCm39) probably benign Het
Ulk1 A T 5: 110,936,810 (GRCm39) probably benign Het
Utp4 T G 8: 107,640,018 (GRCm39) H442Q probably null Het
Vmn1r193 T A 13: 22,403,798 (GRCm39) I65F probably damaging Het
Vps54 A T 11: 21,256,962 (GRCm39) Q690L probably damaging Het
Ybx2 T C 11: 69,831,145 (GRCm39) probably benign Het
Zbtb38 C T 9: 96,568,993 (GRCm39) G697D possibly damaging Het
Zfp202 C T 9: 40,120,212 (GRCm39) Q218* probably null Het
Zfp820 G A 17: 22,038,800 (GRCm39) T176I probably benign Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10,195,100 (GRCm39) missense probably damaging 1.00
IGL02125:Itih5 APN 2 10,245,798 (GRCm39) missense probably benign
IGL02370:Itih5 APN 2 10,191,786 (GRCm39) missense probably benign 0.05
IGL03376:Itih5 APN 2 10,211,584 (GRCm39) missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10,256,162 (GRCm39) missense probably benign 0.01
R0090:Itih5 UTSW 2 10,169,495 (GRCm39) missense probably benign 0.03
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0270:Itih5 UTSW 2 10,256,075 (GRCm39) missense probably benign 0.38
R0276:Itih5 UTSW 2 10,190,375 (GRCm39) missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0810:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0903:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0905:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0906:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R1104:Itih5 UTSW 2 10,256,323 (GRCm39) missense probably benign 0.03
R1397:Itih5 UTSW 2 10,245,618 (GRCm39) missense probably benign 0.14
R1671:Itih5 UTSW 2 10,191,782 (GRCm39) missense probably benign 0.03
R1971:Itih5 UTSW 2 10,243,379 (GRCm39) missense probably damaging 1.00
R3684:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10,256,081 (GRCm39) missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10,250,355 (GRCm39) missense probably damaging 0.98
R4670:Itih5 UTSW 2 10,195,180 (GRCm39) missense probably benign 0.01
R4803:Itih5 UTSW 2 10,245,392 (GRCm39) missense probably benign
R4950:Itih5 UTSW 2 10,239,892 (GRCm39) missense probably damaging 0.98
R5020:Itih5 UTSW 2 10,245,315 (GRCm39) splice site probably null
R5735:Itih5 UTSW 2 10,245,572 (GRCm39) missense probably benign 0.00
R6454:Itih5 UTSW 2 10,245,479 (GRCm39) missense probably benign
R6662:Itih5 UTSW 2 10,253,992 (GRCm39) missense probably benign 0.13
R7019:Itih5 UTSW 2 10,195,138 (GRCm39) missense probably damaging 1.00
R7068:Itih5 UTSW 2 10,254,115 (GRCm39) missense probably damaging 0.99
R7246:Itih5 UTSW 2 10,191,873 (GRCm39) splice site probably null
R7424:Itih5 UTSW 2 10,250,448 (GRCm39) missense probably damaging 1.00
R7452:Itih5 UTSW 2 10,243,607 (GRCm39) missense probably damaging 1.00
R7597:Itih5 UTSW 2 10,254,187 (GRCm39) missense probably damaging 1.00
R8025:Itih5 UTSW 2 10,245,833 (GRCm39) missense probably benign 0.13
R8253:Itih5 UTSW 2 10,243,406 (GRCm39) missense probably benign 0.06
R8349:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8439:Itih5 UTSW 2 10,239,869 (GRCm39) missense probably benign 0.19
R8449:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8825:Itih5 UTSW 2 10,195,231 (GRCm39) missense probably benign 0.00
R9110:Itih5 UTSW 2 10,191,831 (GRCm39) missense probably benign
R9582:Itih5 UTSW 2 10,195,013 (GRCm39) missense probably benign 0.07
R9744:Itih5 UTSW 2 10,256,221 (GRCm39) missense probably damaging 1.00
X0026:Itih5 UTSW 2 10,243,370 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- CAGTTGTGAAGACTCGGTGACCTG -3'
(R):5'- TGGTCATGCCAAAGCTGGATAGAAG -3'

Sequencing Primer
(F):5'- GACTCGGTGACCTGATACACTATG -3'
(R):5'- AGGGCTGTCAGGAATCATTCTTAC -3'
Posted On 2013-04-16