Incidental Mutation 'R0158:Itih5'
ID 22950
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha (globulin) inhibitor H5
Synonyms 5430408M01Rik, 4631408O11Rik
MMRRC Submission 038438-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R0158 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 10153571-10256529 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 10234992 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably benign
Transcript: ENSMUST00000026886
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 93% (79/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T G 1: 26,683,951 H716P probably damaging Het
9530053A07Rik A G 7: 28,155,492 I1848V probably damaging Het
Abcf3 C T 16: 20,552,566 R437C probably damaging Het
Abhd3 A G 18: 10,647,840 Y315H possibly damaging Het
Adam19 C T 11: 46,143,034 P891L probably damaging Het
Ampd1 T A 3: 103,091,730 Y400* probably null Het
Ap1g1 T C 8: 109,855,635 S724P probably benign Het
BC067074 T A 13: 113,369,153 L2272* probably null Het
Bst2 T A 8: 71,537,217 T71S possibly damaging Het
C3 A G 17: 57,224,851 probably null Het
Cacna2d1 C A 5: 16,361,817 probably benign Het
Cacna2d4 C T 6: 119,236,748 H43Y possibly damaging Het
Ccdc71 T G 9: 108,464,137 V383G probably benign Het
Cd109 A T 9: 78,688,932 Q849L possibly damaging Het
Cdkn2a A T 4: 89,276,767 H115Q possibly damaging Het
Ces1e T C 8: 93,219,429 E161G probably benign Het
Cggbp1 C T 16: 64,855,838 S89L possibly damaging Het
Crocc A T 4: 141,042,242 probably benign Het
Eef1akmt3 G A 10: 127,033,273 Q111* probably null Het
Exoc7 T C 11: 116,295,292 N361S probably benign Het
Fat2 G T 11: 55,296,185 S1278R probably benign Het
Fbxo42 A G 4: 141,200,329 N640S probably benign Het
Fbxw25 A G 9: 109,654,652 V164A possibly damaging Het
Foxs1 T C 2: 152,932,410 E241G probably damaging Het
Fras1 A T 5: 96,776,634 I3645F possibly damaging Het
Gm14496 T A 2: 181,997,413 V432E probably benign Het
Herc1 T A 9: 66,495,921 L4374* probably null Het
Hist1h3b T A 13: 23,752,710 C111S probably damaging Het
Ift122 T C 6: 115,924,484 probably benign Het
Itgav C A 2: 83,792,037 N654K probably benign Het
Jak2 C A 19: 29,311,757 T1103K probably benign Het
Kcnc4 C A 3: 107,458,604 C96F probably benign Het
Med13l C A 5: 118,742,449 S1202Y unknown Het
Mefv T C 16: 3,715,456 E317G possibly damaging Het
Ncoa2 T C 1: 13,152,384 T1226A probably benign Het
Nktr C T 9: 121,750,691 probably benign Het
Nudt5 G A 2: 5,862,303 V61M probably damaging Het
Olfr33 C T 7: 102,713,955 A153T probably benign Het
Palm2 A G 4: 57,709,649 D198G possibly damaging Het
Papd5 G A 8: 88,250,743 G391D probably damaging Het
Pcdhb2 A C 18: 37,297,230 Y752S probably damaging Het
Pcnx4 A G 12: 72,556,302 D446G probably benign Het
Pnp2 G A 14: 50,964,304 R249H probably damaging Het
Rgs3 A T 4: 62,623,884 I32F probably damaging Het
Rnf139 A G 15: 58,898,878 T251A probably benign Het
Rnf41 A G 10: 128,438,235 E252G probably damaging Het
Rxfp2 T A 5: 150,051,628 F220Y probably benign Het
Sdcbp A G 4: 6,379,042 D43G possibly damaging Het
Serpina3f A G 12: 104,217,008 D43G probably damaging Het
Sftpc T C 14: 70,521,447 K154R probably null Het
Simc1 A G 13: 54,524,717 T293A probably benign Het
Skint6 A T 4: 113,184,814 probably benign Het
Slc6a15 T C 10: 103,389,347 probably benign Het
Ston2 A T 12: 91,740,602 I78N probably damaging Het
Taok3 T C 5: 117,217,242 probably null Het
Tiam1 C T 16: 89,793,001 probably benign Het
Tnfsf15 T C 4: 63,729,992 H137R possibly damaging Het
Tpte G A 8: 22,327,739 R247H possibly damaging Het
Trim2 T C 3: 84,210,169 probably benign Het
Ulk1 A T 5: 110,788,944 probably benign Het
Utp4 T G 8: 106,913,386 H442Q probably null Het
Vmn1r193 T A 13: 22,219,628 I65F probably damaging Het
Vps54 A T 11: 21,306,962 Q690L probably damaging Het
Ybx2 T C 11: 69,940,319 probably benign Het
Zbtb38 C T 9: 96,686,940 G697D possibly damaging Het
Zfp202 C T 9: 40,208,916 Q218* probably null Het
Zfp820 G A 17: 21,819,819 T176I probably benign Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10190289 missense probably damaging 1.00
IGL02125:Itih5 APN 2 10240987 missense probably benign
IGL02370:Itih5 APN 2 10186975 missense probably benign 0.05
IGL03376:Itih5 APN 2 10206773 missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10251351 missense probably benign 0.01
R0090:Itih5 UTSW 2 10164684 missense probably benign 0.03
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0270:Itih5 UTSW 2 10251264 missense probably benign 0.38
R0276:Itih5 UTSW 2 10185564 missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0810:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0903:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0905:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0906:Itih5 UTSW 2 10249188 missense probably benign 0.00
R1104:Itih5 UTSW 2 10251512 missense probably benign 0.03
R1397:Itih5 UTSW 2 10240807 missense probably benign 0.14
R1671:Itih5 UTSW 2 10186971 missense probably benign 0.03
R1971:Itih5 UTSW 2 10238568 missense probably damaging 1.00
R3684:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10251270 missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10245544 missense probably damaging 0.98
R4670:Itih5 UTSW 2 10190369 missense probably benign 0.01
R4803:Itih5 UTSW 2 10240581 missense probably benign
R4950:Itih5 UTSW 2 10235081 missense probably damaging 0.98
R5020:Itih5 UTSW 2 10240504 splice site probably null
R5735:Itih5 UTSW 2 10240761 missense probably benign 0.00
R6454:Itih5 UTSW 2 10240668 missense probably benign
R6662:Itih5 UTSW 2 10249181 missense probably benign 0.13
R7019:Itih5 UTSW 2 10190327 missense probably damaging 1.00
R7068:Itih5 UTSW 2 10249304 missense probably damaging 0.99
R7246:Itih5 UTSW 2 10187062 splice site probably null
R7424:Itih5 UTSW 2 10245637 missense probably damaging 1.00
R7452:Itih5 UTSW 2 10238796 missense probably damaging 1.00
R7597:Itih5 UTSW 2 10249376 missense probably damaging 1.00
R8025:Itih5 UTSW 2 10241022 missense probably benign 0.13
R8253:Itih5 UTSW 2 10238595 missense probably benign 0.06
R8349:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8439:Itih5 UTSW 2 10235058 missense probably benign 0.19
R8449:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8825:Itih5 UTSW 2 10190420 missense probably benign 0.00
R9110:Itih5 UTSW 2 10187020 missense probably benign
R9582:Itih5 UTSW 2 10190202 missense probably benign 0.07
X0026:Itih5 UTSW 2 10238559 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAGTTGTGAAGACTCGGTGACCTG -3'
(R):5'- TGGTCATGCCAAAGCTGGATAGAAG -3'

Sequencing Primer
(F):5'- GACTCGGTGACCTGATACACTATG -3'
(R):5'- AGGGCTGTCAGGAATCATTCTTAC -3'
Posted On 2013-04-16