Incidental Mutation 'R2081:Sec23a'
ID229511
Institutional Source Beutler Lab
Gene Symbol Sec23a
Ensembl Gene ENSMUSG00000020986
Gene NameSEC23 homolog A, COPII coat complex component
SynonymsSec23r, Msec23
MMRRC Submission 040086-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R2081 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location58958383-59012017 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 58998281 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 192 (Q192*)
Ref Sequence ENSEMBL: ENSMUSP00000126011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021375] [ENSMUST00000165134]
Predicted Effect probably null
Transcript: ENSMUST00000021375
AA Change: Q221*
SMART Domains Protein: ENSMUSP00000021375
Gene: ENSMUSG00000020986
AA Change: Q221*

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 2.7e-17 PFAM
Pfam:Sec23_trunk 126 390 2e-81 PFAM
Pfam:Sec23_BS 401 504 3.2e-35 PFAM
Pfam:Sec23_helical 520 618 1e-30 PFAM
Pfam:Gelsolin 629 718 9.3e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165134
AA Change: Q192*
SMART Domains Protein: ENSMUSP00000126011
Gene: ENSMUSG00000020986
AA Change: Q192*

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 57 98 8.1e-16 PFAM
Pfam:Sec23_trunk 97 361 6.5e-84 PFAM
Pfam:Sec23_BS 372 475 3.8e-36 PFAM
Pfam:Sec23_helical 490 590 1.6e-38 PFAM
Pfam:Gelsolin 599 689 2.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family. It is part of a protein complex and found in the ribosome-free transitional face of the endoplasmic reticulum (ER) and associated vesicles. This protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The encoded protein is suggested to play a role in the ER-Golgi protein trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die during mid-embryogenesis exhibiting defects in neural tube closure and extraembryonic membrane formation as well as broad secretion defects of multiple collagen species in different tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,320,259 T28A possibly damaging Het
Actl11 G A 9: 107,930,197 G573D probably benign Het
Adam39 T A 8: 40,826,842 *757K probably null Het
Agpat4 T C 17: 12,151,884 I38T possibly damaging Het
Akap2 G A 4: 57,855,927 E419K possibly damaging Het
Ap3d1 A C 10: 80,732,936 I36S probably damaging Het
Arhgap45 T C 10: 80,027,674 F784L probably damaging Het
Atp10b T A 11: 43,202,128 I430N probably damaging Het
Atrip T A 9: 109,072,739 probably null Het
C2cd4b G T 9: 67,760,577 R285L probably damaging Het
Camta1 T C 4: 151,144,242 E711G probably benign Het
Clcn6 T C 4: 148,011,068 Y685C probably damaging Het
Col18a1 T A 10: 77,054,185 D1447V probably damaging Het
Crispld1 T A 1: 17,762,179 V463D probably damaging Het
Crybg2 T G 4: 134,088,820 F1612V possibly damaging Het
Dclk1 T C 3: 55,521,925 probably null Het
Ddx46 G T 13: 55,674,016 V834L probably benign Het
Dnah10 A G 5: 124,774,981 D1734G possibly damaging Het
Dpep1 T C 8: 123,199,378 V152A probably damaging Het
Ect2l T C 10: 18,165,527 E301G probably damaging Het
Elf3 C T 1: 135,257,076 C124Y probably benign Het
Eno2 A G 6: 124,763,125 V316A probably damaging Het
Erap1 A G 13: 74,675,307 E820G possibly damaging Het
Evpl A T 11: 116,234,266 H123Q probably damaging Het
Fat2 T A 11: 55,309,677 Y857F possibly damaging Het
Fbrsl1 T A 5: 110,371,625 probably null Het
Fbxw7 A G 3: 84,974,513 D432G probably damaging Het
Flt1 A T 5: 147,639,422 L592Q probably damaging Het
Gm14496 T A 2: 182,000,479 C648S probably damaging Het
Gm5150 A T 3: 15,990,945 S39T probably benign Het
Gm5426 T C 10: 96,136,739 I46T possibly damaging Het
Gse1 C A 8: 120,566,480 P177Q probably damaging Het
Heatr4 G A 12: 83,980,322 R54W probably damaging Het
Hpgd C A 8: 56,307,642 Q125K probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Mast2 A T 4: 116,330,474 probably null Het
Mfsd11 A G 11: 116,861,555 T177A possibly damaging Het
Mlx T C 11: 101,087,431 S36P probably benign Het
Mlxipl T A 5: 135,113,638 V102D probably damaging Het
Mms22l T C 4: 24,536,150 Y540H probably damaging Het
Msc T C 1: 14,755,717 D11G probably benign Het
Muc4 C G 16: 32,752,220 S699R probably benign Het
Nckap1l T C 15: 103,497,454 S1106P probably damaging Het
Obscn T C 11: 59,034,182 E5703G possibly damaging Het
Olfr705 A G 7: 106,714,198 M161T probably benign Het
Pabpn1 A G 14: 54,895,658 K38E probably damaging Het
Padi3 A T 4: 140,798,979 L141Q probably damaging Het
Pde3b A G 7: 114,523,422 N742D probably benign Het
Pex1 T A 5: 3,624,132 probably null Het
Pkd2 T C 5: 104,460,211 V192A probably benign Het
Ppp6r2 T A 15: 89,282,129 M750K probably benign Het
Prdm15 A T 16: 97,803,780 Y783* probably null Het
Prox2 T A 12: 85,095,008 Q140H probably damaging Het
Psg27 A T 7: 18,556,958 I440K probably damaging Het
Pzp A G 6: 128,519,420 M283T probably benign Het
Sh2b1 A G 7: 126,472,690 S108P possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tkfc G A 19: 10,597,378 A166V probably damaging Het
Tomm70a T C 16: 57,140,758 V358A probably damaging Het
Trim47 A G 11: 116,106,413 F505S probably damaging Het
Tti2 T C 8: 31,151,309 F154L possibly damaging Het
Ubap2l C T 3: 90,038,964 G111D possibly damaging Het
Usp9y A T Y: 1,381,277 I848N possibly damaging Het
Veph1 T C 3: 66,061,102 Y740C probably damaging Het
Vmn2r114 T A 17: 23,291,109 H799L possibly damaging Het
Wdr31 T A 4: 62,455,943 M270L probably benign Het
Zfp26 A G 9: 20,436,617 S884P probably benign Het
Zswim6 T A 13: 107,773,395 noncoding transcript Het
Other mutations in Sec23a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Sec23a APN 12 58992282 missense possibly damaging 0.47
IGL01836:Sec23a APN 12 58971287 missense probably damaging 0.98
IGL01906:Sec23a APN 12 59007044 missense probably damaging 1.00
IGL02383:Sec23a APN 12 59002027 missense probably damaging 1.00
IGL02507:Sec23a APN 12 59007098 missense probably benign 0.34
IGL02816:Sec23a APN 12 58978545 missense probably benign 0.03
IGL03060:Sec23a APN 12 58986105 missense probably benign
R0308:Sec23a UTSW 12 59007199 nonsense probably null
R0361:Sec23a UTSW 12 58991018 missense probably damaging 1.00
R0546:Sec23a UTSW 12 58985167 missense probably benign 0.07
R0720:Sec23a UTSW 12 58971271 missense probably damaging 1.00
R1084:Sec23a UTSW 12 58985135 missense probably damaging 0.97
R1156:Sec23a UTSW 12 59001836 missense probably benign
R1438:Sec23a UTSW 12 59002010 missense probably damaging 0.98
R1446:Sec23a UTSW 12 58978559 missense probably damaging 1.00
R1526:Sec23a UTSW 12 58986186 splice site probably null
R1705:Sec23a UTSW 12 59001866 missense possibly damaging 0.95
R1997:Sec23a UTSW 12 59002007 missense probably benign
R2051:Sec23a UTSW 12 58990968 splice site probably null
R4201:Sec23a UTSW 12 59002005 missense probably benign 0.00
R4706:Sec23a UTSW 12 58982586 missense probably damaging 0.98
R4724:Sec23a UTSW 12 58978506 missense probably damaging 0.99
R4969:Sec23a UTSW 12 59004488 critical splice donor site probably null
R5375:Sec23a UTSW 12 59007005 missense probably benign 0.15
R5858:Sec23a UTSW 12 58973035 missense probably damaging 0.98
R6539:Sec23a UTSW 12 58985212 missense probably benign 0.00
R6558:Sec23a UTSW 12 59004552 missense probably benign 0.03
R6616:Sec23a UTSW 12 58997155 missense possibly damaging 0.95
R6716:Sec23a UTSW 12 58968823 missense probably benign 0.09
R7078:Sec23a UTSW 12 58992283 missense probably benign 0.07
R7155:Sec23a UTSW 12 58989443 missense probably benign 0.03
R7367:Sec23a UTSW 12 58966999 missense probably benign
R7923:Sec23a UTSW 12 58992247 missense probably damaging 0.99
R8178:Sec23a UTSW 12 59007194 missense possibly damaging 0.93
R8557:Sec23a UTSW 12 59005270 missense probably damaging 0.96
R8839:Sec23a UTSW 12 58990995 missense possibly damaging 0.79
Z1088:Sec23a UTSW 12 59004576 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTCCACAAACCACATGAAGATTC -3'
(R):5'- TGCCTTCTGGGAAAAGCAAAC -3'

Sequencing Primer
(F):5'- TTTCAGTCAAAAAGAAATGGCCAC -3'
(R):5'- GCCTTCTGGGAAAAGCAAACTTATG -3'
Posted On2014-09-17