Mutagenetix > Incidental Mutations

Incidental Mutation 'R2122:Col4a3'

229535

Institutional Source

Beutler Lab

Gene Symbol

Col4a3

Ensembl Gene

ENSMUSG00000079465

Gene Name

collagen, type IV, alpha 3

Synonyms

alpha3(IV), tumstatin

MMRRC Submission

040126-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2122 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82586921-82722059 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 82654957 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 184 (F184V)

Ref Sequence

ENSEMBL: ENSMUSP00000109084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113457]

Predicted Effect

unknown
Transcript: ENSMUST00000113457
AA Change: F184V

SMART Domains

Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465
AA Change: F184V

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Collagen	41	102	9.6e-11	PFAM
Pfam:Collagen	97	164	3.6e-11	PFAM
Pfam:Collagen	164	223	3.6e-9	PFAM
low complexity region	233	243	N/A	INTRINSIC
Pfam:Collagen	284	344	2.4e-10	PFAM
low complexity region	368	393	N/A	INTRINSIC
Pfam:Collagen	415	477	5e-10	PFAM
Pfam:Collagen	481	545	1e-9	PFAM
low complexity region	550	585	N/A	INTRINSIC
Pfam:Collagen	588	653	8.9e-9	PFAM
Pfam:Collagen	682	744	1.1e-8	PFAM
Pfam:Collagen	743	807	6.9e-10	PFAM
Pfam:Collagen	786	847	1.5e-8	PFAM
Pfam:Collagen	845	904	1.5e-10	PFAM
Pfam:Collagen	887	946	4.1e-10	PFAM
Pfam:Collagen	948	1006	8.1e-11	PFAM
Pfam:Collagen	997	1061	2.8e-10	PFAM
Pfam:Collagen	1057	1120	2.5e-10	PFAM
Pfam:Collagen	1114	1176	1.7e-9	PFAM
Pfam:Collagen	1174	1233	1.1e-9	PFAM
Pfam:Collagen	1232	1295	6.9e-9	PFAM
low complexity region	1326	1347	N/A	INTRINSIC
Pfam:Collagen	1377	1439	4.9e-11	PFAM
C4	1444	1553	3.77e-70	SMART
C4	1554	1667	3.28e-70	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	G	T	7: 120,519,961	G975V	probably damaging	Het
Abcg5	T	A	17: 84,671,147	E294D	probably benign	Het
Actl10	G	A	2: 154,552,233	R35H	probably damaging	Het
Adamts12	C	T	15: 11,310,579	T974I	probably damaging	Het
Ahctf1	C	A	1: 179,769,452	R43L	probably damaging	Het
Arhgef10	A	G	8: 14,934,820	D200G	probably damaging	Het
Arhgef38	T	C	3: 133,160,753	K208E	probably benign	Het
Arhgef7	A	T	8: 11,728,256	N2I	possibly damaging	Het
Blvra	T	G	2: 127,086,897	S102A	probably damaging	Het
Btn1a1	A	G	13: 23,461,521	L226P	probably damaging	Het
C2cd4d	G	T	3: 94,363,618	E64*	probably null	Het
Ccna2	A	G	3: 36,568,726	V209A	probably damaging	Het
Cd55	T	A	1: 130,459,617	D148V	possibly damaging	Het
Cdh2	G	A	18: 16,774,543	P46L	probably benign	Het
Cldn11	A	G	3: 31,163,151	Y156C	probably damaging	Het
Cmtm2a	T	C	8: 104,293,023	R12G	possibly damaging	Het
Cog2	T	C	8: 124,528,985	S104P	possibly damaging	Het
Col4a4	T	A	1: 82,456,871	D1406V	unknown	Het
Col6a1	T	C	10: 76,721,498	T207A	probably benign	Het
Cyp2a12	A	G	7: 27,036,646	*493W	probably null	Het
Dcdc2a	T	G	13: 25,119,285	S266R	possibly damaging	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Ecel1	A	G	1: 87,148,275	S727P	probably damaging	Het
Eif2ak4	T	A	2: 118,455,793	V1063E	probably damaging	Het
Enpp2	A	T	15: 54,897,792	Y44*	probably null	Het
Ep400	A	T	5: 110,708,850		probably benign	Het
Exoc6b	A	G	6: 84,621,482	M779T	probably benign	Het
F13a1	T	A	13: 37,025,679	Y104F	probably benign	Het
Fam78b	G	A	1: 167,078,709	V146M	probably damaging	Het
Fgf18	A	C	11: 33,118,003	F129C	probably damaging	Het
Fscn3	A	G	6: 28,430,389	D186G	probably benign	Het
Gm5773	G	A	3: 93,773,317	G99R	possibly damaging	Het
Grk1	A	T	8: 13,405,221	Y35F	probably benign	Het
Heatr1	T	C	13: 12,403,264	V359A	probably benign	Het
Hfm1	A	G	5: 106,896,255	S567P	probably damaging	Het
Il1rap	A	T	16: 26,710,565	H379L	probably damaging	Het
Kctd5	T	C	17: 24,055,966	T212A	probably benign	Het
Krtap5-5	A	T	7: 142,229,503	C137S	unknown	Het
Lrp2	T	C	2: 69,483,707	T2227A	probably damaging	Het
Ltbp1	T	A	17: 75,310,159	V1031E	possibly damaging	Het
Ltbr	A	G	6: 125,309,477	S249P	probably benign	Het
Map1a	T	A	2: 121,299,446	Y248N	probably damaging	Het
Mdc1	C	T	17: 35,847,943	A405V	probably benign	Het
Mfsd4b1	T	C	10: 40,002,651	K417E	possibly damaging	Het
Mroh2a	T	C	1: 88,256,754	V1453A	probably benign	Het
Myh11	T	C	16: 14,218,004	E1027G	probably damaging	Het
Nudt6	A	C	3: 37,412,405	F80L	probably benign	Het
Nxph1	A	G	6: 9,247,791	K254R	probably damaging	Het
Obsl1	C	T	1: 75,493,883	R1043H	probably benign	Het
Olfr17	A	T	7: 107,098,109	I215F	probably damaging	Het
Pde6d	A	G	1: 86,545,802	F91L	probably benign	Het
Phldb2	T	A	16: 45,762,941	I1065F	probably damaging	Het
Ppp1r3a	A	T	6: 14,721,875	N317K	possibly damaging	Het
Psmd1	T	A	1: 86,078,700	S263T	possibly damaging	Het
Pum1	C	A	4: 130,669,270	T112K	possibly damaging	Het
Rasgrp2	T	A	19: 6,404,395	M156K	probably benign	Het
Reg3a	T	C	6: 78,381,136	C17R	possibly damaging	Het
Ripor2	A	G	13: 24,713,718	S800G	probably damaging	Het
Rnf168	T	G	16: 32,278,218	L37R	probably damaging	Het
Rnf31	A	G	14: 55,596,197	D554G	probably damaging	Het
Rpe	T	C	1: 66,715,228	M153T	probably damaging	Het
Sacs	A	T	14: 61,212,316	Q3937L	probably damaging	Het
Sap18	T	A	14: 57,798,554	S66T	probably damaging	Het
Slc20a1	T	G	2: 129,199,819	I34S	possibly damaging	Het
Slc25a30	A	G	14: 75,770,218	S116P	possibly damaging	Het
Speer4c	T	A	5: 15,714,117	D29V	possibly damaging	Het
Stk40	C	T	4: 126,128,847	T138I	probably benign	Het
Susd3	A	G	13: 49,231,150	Y254H	probably damaging	Het
Tanc2	T	C	11: 105,895,949	L858P	probably damaging	Het
Tas2r106	A	T	6: 131,678,354	L178H	probably damaging	Het
Tfpt	C	T	7: 3,628,931	R60Q	probably damaging	Het
Tmem44	T	A	16: 30,547,444	K55*	probably null	Het
Tnfsf9	A	T	17: 57,107,316		probably null	Het
Ube3c	T	C	5: 29,619,606	I543T	probably benign	Het
Ugt1a2	C	A	1: 88,201,013	S126Y	possibly damaging	Het
Vmn1r180	T	A	7: 23,953,141	L243Q	probably damaging	Het
Vmn2r15	A	C	5: 109,286,456	V794G	probably damaging	Het
Vmn2r24	A	G	6: 123,815,394	D560G	possibly damaging	Het
Wdr11	G	A	7: 129,631,766	C1028Y	probably damaging	Het
Zfp318	A	G	17: 46,413,371	D2100G	probably benign	Het
Zfyve16	A	T	13: 92,519,483	Y789*	probably null	Het

Other mutations in Col4a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Col4a3	APN	1	82697754	missense	unknown
IGL00847:Col4a3	APN	1	82717869	missense	probably damaging	1.00
IGL01011:Col4a3	APN	1	82682301	missense	unknown
IGL01102:Col4a3	APN	1	82669720	missense	unknown
IGL01102:Col4a3	APN	1	82670255	missense	unknown
IGL02071:Col4a3	APN	1	82660887	critical splice donor site	probably null
IGL02244:Col4a3	APN	1	82669771	splice site	probably benign
IGL02380:Col4a3	APN	1	82672788	splice site	probably benign
IGL02431:Col4a3	APN	1	82679623	nonsense	probably null
IGL02466:Col4a3	APN	1	82670192	missense	unknown
IGL02694:Col4a3	APN	1	82710794	unclassified	probably benign
IGL02709:Col4a3	APN	1	82679112	missense	unknown
IGL02752:Col4a3	APN	1	82660225	missense	unknown
IGL02792:Col4a3	APN	1	82718803	missense	probably damaging	1.00
IGL03203:Col4a3	APN	1	82672639	nonsense	probably null
IGL03218:Col4a3	APN	1	82643206	splice site	probably benign
FR4976:Col4a3	UTSW	1	82718906	frame shift	probably null
PIT4260001:Col4a3	UTSW	1	82682761	missense	unknown
PIT4515001:Col4a3	UTSW	1	82682303	missense	unknown
R0035:Col4a3	UTSW	1	82672753	missense	unknown
R0099:Col4a3	UTSW	1	82717993	missense	probably benign	0.41
R0433:Col4a3	UTSW	1	82670219	missense	unknown
R0573:Col4a3	UTSW	1	82716363	missense	possibly damaging	0.83
R0606:Col4a3	UTSW	1	82672586	splice site	probably benign
R0715:Col4a3	UTSW	1	82652158	splice site	probably benign
R0961:Col4a3	UTSW	1	82708576	splice site	probably benign
R1257:Col4a3	UTSW	1	82716365	missense	probably damaging	1.00
R1264:Col4a3	UTSW	1	82643301	splice site	probably benign
R1373:Col4a3	UTSW	1	82690087	splice site	probably benign
R1694:Col4a3	UTSW	1	82690663	splice site	probably null
R1895:Col4a3	UTSW	1	82679108	missense	unknown
R1925:Col4a3	UTSW	1	82700373	missense	unknown
R1925:Col4a3	UTSW	1	82711874	unclassified	probably benign
R2033:Col4a3	UTSW	1	82718011	intron	probably benign
R2044:Col4a3	UTSW	1	82696319	missense	unknown
R2282:Col4a3	UTSW	1	82708638	missense	unknown
R2318:Col4a3	UTSW	1	82648569	splice site	probably null
R2421:Col4a3	UTSW	1	82670275	splice site	probably benign
R2517:Col4a3	UTSW	1	82680710	missense	unknown
R2965:Col4a3	UTSW	1	82648600	missense	unknown
R3085:Col4a3	UTSW	1	82651258	missense	unknown
R3150:Col4a3	UTSW	1	82657137	splice site	probably null
R3947:Col4a3	UTSW	1	82715332	missense	probably damaging	1.00
R4756:Col4a3	UTSW	1	82716297	critical splice acceptor site	probably null
R4910:Col4a3	UTSW	1	82672679	missense	unknown
R4928:Col4a3	UTSW	1	82710977	unclassified	probably benign
R5044:Col4a3	UTSW	1	82666546	missense	unknown
R5557:Col4a3	UTSW	1	82715247	unclassified	probably benign
R5761:Col4a3	UTSW	1	82716057	nonsense	probably null
R5970:Col4a3	UTSW	1	82716329	missense	possibly damaging	0.76
R6576:Col4a3	UTSW	1	82708574	splice site	probably null
R6583:Col4a3	UTSW	1	82641476	missense	unknown
R6675:Col4a3	UTSW	1	82668925	missense	unknown
R7170:Col4a3	UTSW	1	82715909	splice site	probably null
R7592:Col4a3	UTSW	1	82648617	missense	unknown
R7624:Col4a3	UTSW	1	82718884	missense	probably benign
R7994:Col4a3	UTSW	1	82662906	missense	unknown
R8127:Col4a3	UTSW	1	82649760	missense	unknown
X0067:Col4a3	UTSW	1	82716159	missense	probably damaging	0.99
Z1177:Col4a3	UTSW	1	82690039	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATCAGATGTCCCAGGCATCTG -3'
(R):5'- AGTTAGACTTACTTTGGGTCCTC -3'

Sequencing Primer
(F):5'- CCAGGCATCTGTATCTGATAGCAG -3'
(R):5'- ATTGCTCCTGGTAAACCCTAG -3'

Posted On

2014-09-17