Incidental Mutation 'R2122:Hfm1'
ID229565
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene NameHFM1, ATP-dependent DNA helicase homolog
SynonymsLOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission 040126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R2122 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location106840192-106926321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106896255 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 567 (S567P)
Ref Sequence ENSEMBL: ENSMUSP00000112590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495]
Predicted Effect probably damaging
Transcript: ENSMUST00000112690
AA Change: S567P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: S567P

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000117588
AA Change: S567P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: S567P

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G T 7: 120,519,961 G975V probably damaging Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Actl10 G A 2: 154,552,233 R35H probably damaging Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Arhgef7 A T 8: 11,728,256 N2I possibly damaging Het
Blvra T G 2: 127,086,897 S102A probably damaging Het
Btn1a1 A G 13: 23,461,521 L226P probably damaging Het
C2cd4d G T 3: 94,363,618 E64* probably null Het
Ccna2 A G 3: 36,568,726 V209A probably damaging Het
Cd55 T A 1: 130,459,617 D148V possibly damaging Het
Cdh2 G A 18: 16,774,543 P46L probably benign Het
Cldn11 A G 3: 31,163,151 Y156C probably damaging Het
Cmtm2a T C 8: 104,293,023 R12G possibly damaging Het
Cog2 T C 8: 124,528,985 S104P possibly damaging Het
Col4a3 T G 1: 82,654,957 F184V unknown Het
Col4a4 T A 1: 82,456,871 D1406V unknown Het
Col6a1 T C 10: 76,721,498 T207A probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dcdc2a T G 13: 25,119,285 S266R possibly damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Eif2ak4 T A 2: 118,455,793 V1063E probably damaging Het
Enpp2 A T 15: 54,897,792 Y44* probably null Het
Ep400 A T 5: 110,708,850 probably benign Het
Exoc6b A G 6: 84,621,482 M779T probably benign Het
F13a1 T A 13: 37,025,679 Y104F probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Fscn3 A G 6: 28,430,389 D186G probably benign Het
Gm5773 G A 3: 93,773,317 G99R possibly damaging Het
Grk1 A T 8: 13,405,221 Y35F probably benign Het
Heatr1 T C 13: 12,403,264 V359A probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Kctd5 T C 17: 24,055,966 T212A probably benign Het
Krtap5-5 A T 7: 142,229,503 C137S unknown Het
Lrp2 T C 2: 69,483,707 T2227A probably damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Map1a T A 2: 121,299,446 Y248N probably damaging Het
Mdc1 C T 17: 35,847,943 A405V probably benign Het
Mfsd4b1 T C 10: 40,002,651 K417E possibly damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh11 T C 16: 14,218,004 E1027G probably damaging Het
Nudt6 A C 3: 37,412,405 F80L probably benign Het
Nxph1 A G 6: 9,247,791 K254R probably damaging Het
Obsl1 C T 1: 75,493,883 R1043H probably benign Het
Olfr17 A T 7: 107,098,109 I215F probably damaging Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Phldb2 T A 16: 45,762,941 I1065F probably damaging Het
Ppp1r3a A T 6: 14,721,875 N317K possibly damaging Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reg3a T C 6: 78,381,136 C17R possibly damaging Het
Ripor2 A G 13: 24,713,718 S800G probably damaging Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
Rnf31 A G 14: 55,596,197 D554G probably damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sacs A T 14: 61,212,316 Q3937L probably damaging Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Slc20a1 T G 2: 129,199,819 I34S possibly damaging Het
Slc25a30 A G 14: 75,770,218 S116P possibly damaging Het
Speer4c T A 5: 15,714,117 D29V possibly damaging Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Susd3 A G 13: 49,231,150 Y254H probably damaging Het
Tanc2 T C 11: 105,895,949 L858P probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tfpt C T 7: 3,628,931 R60Q probably damaging Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Tnfsf9 A T 17: 57,107,316 probably null Het
Ube3c T C 5: 29,619,606 I543T probably benign Het
Ugt1a2 C A 1: 88,201,013 S126Y possibly damaging Het
Vmn1r180 T A 7: 23,953,141 L243Q probably damaging Het
Vmn2r15 A C 5: 109,286,456 V794G probably damaging Het
Vmn2r24 A G 6: 123,815,394 D560G possibly damaging Het
Wdr11 G A 7: 129,631,766 C1028Y probably damaging Het
Zfp318 A G 17: 46,413,371 D2100G probably benign Het
Zfyve16 A T 13: 92,519,483 Y789* probably null Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 106902130 missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 106917606 missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 106917379 missense probably benign 0.00
IGL01758:Hfm1 APN 5 106904793 missense probably damaging 0.99
IGL01911:Hfm1 APN 5 106911544 missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 106904267 missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 106873928 splice site probably benign
IGL02496:Hfm1 APN 5 106901761 missense probably benign 0.00
IGL02545:Hfm1 APN 5 106895287 missense probably damaging 1.00
IGL02584:Hfm1 APN 5 106878662 splice site probably null
IGL02728:Hfm1 APN 5 106878823 missense probably benign 0.13
IGL02881:Hfm1 APN 5 106874252 missense probably damaging 1.00
IGL03108:Hfm1 APN 5 106895934 unclassified probably benign
IGL03351:Hfm1 APN 5 106911575 nonsense probably null
IGL03353:Hfm1 APN 5 106856929 missense probably damaging 0.99
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0094:Hfm1 UTSW 5 106917478 missense probably benign
R0633:Hfm1 UTSW 5 106917601 missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 106898256 critical splice donor site probably null
R1078:Hfm1 UTSW 5 106878830 missense probably damaging 1.00
R1120:Hfm1 UTSW 5 106904218 splice site probably benign
R1166:Hfm1 UTSW 5 106911411 missense probably benign 0.00
R1242:Hfm1 UTSW 5 106874901 missense probably damaging 0.99
R1414:Hfm1 UTSW 5 106872353 missense probably benign 0.01
R1450:Hfm1 UTSW 5 106918458 missense probably damaging 0.99
R1529:Hfm1 UTSW 5 106853123 missense probably benign 0.00
R1622:Hfm1 UTSW 5 106893523 missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 106880514 missense probably damaging 1.00
R1710:Hfm1 UTSW 5 106896003 missense probably damaging 0.96
R1757:Hfm1 UTSW 5 106880360 splice site probably null
R1856:Hfm1 UTSW 5 106847676 missense probably benign 0.00
R1984:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R1985:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R2040:Hfm1 UTSW 5 106901818 missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106847653 splice site probably null
R2474:Hfm1 UTSW 5 106872416 missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 106874282 nonsense probably null
R2944:Hfm1 UTSW 5 106872330 missense probably damaging 1.00
R3705:Hfm1 UTSW 5 106892839 unclassified probably benign
R4256:Hfm1 UTSW 5 106904797 missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 106886508 splice site probably null
R4538:Hfm1 UTSW 5 106874890 missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 106874221 nonsense probably null
R4591:Hfm1 UTSW 5 106847667 missense probably benign 0.08
R4745:Hfm1 UTSW 5 106901843 missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 106917523 missense probably benign
R4765:Hfm1 UTSW 5 106842539 missense probably benign 0.21
R4821:Hfm1 UTSW 5 106854740 critical splice donor site probably null
R4842:Hfm1 UTSW 5 106892751 missense probably damaging 1.00
R4944:Hfm1 UTSW 5 106874213 missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 106901731 missense probably damaging 1.00
R5399:Hfm1 UTSW 5 106917562 missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 106902076 missense probably damaging 1.00
R5436:Hfm1 UTSW 5 106892772 missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106847662 critical splice donor site probably null
R5585:Hfm1 UTSW 5 106911439 missense probably benign 0.05
R5631:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5705:Hfm1 UTSW 5 106911453 missense probably benign 0.21
R5804:Hfm1 UTSW 5 106878589 splice site probably null
R5959:Hfm1 UTSW 5 106874917 missense probably damaging 1.00
R6046:Hfm1 UTSW 5 106898643 splice site probably null
R6191:Hfm1 UTSW 5 106886553 missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106841638 missense probably benign
R6580:Hfm1 UTSW 5 106847709 missense probably benign 0.00
R6651:Hfm1 UTSW 5 106847687 missense probably benign 0.00
R6761:Hfm1 UTSW 5 106895279 missense probably damaging 1.00
R6835:Hfm1 UTSW 5 106878815 nonsense probably null
R6891:Hfm1 UTSW 5 106917374 missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106850410 splice site probably null
R6980:Hfm1 UTSW 5 106880477 missense probably benign 0.31
R7054:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7058:Hfm1 UTSW 5 106911440 missense probably benign 0.04
R7189:Hfm1 UTSW 5 106901703 critical splice donor site probably null
R7250:Hfm1 UTSW 5 106904331 missense probably benign 0.00
R7376:Hfm1 UTSW 5 106895218 missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7636:Hfm1 UTSW 5 106917466 missense probably benign 0.02
R7639:Hfm1 UTSW 5 106889925 missense probably benign 0.03
R7639:Hfm1 UTSW 5 106898475 missense possibly damaging 0.46
R7763:Hfm1 UTSW 5 106881861 missense probably damaging 1.00
R7828:Hfm1 UTSW 5 106881791 critical splice donor site probably null
R7905:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
R8160:Hfm1 UTSW 5 106896033 missense probably null 0.00
R8477:Hfm1 UTSW 5 106881818 missense probably benign 0.01
R8739:Hfm1 UTSW 5 106898505 missense probably damaging 0.96
Z1177:Hfm1 UTSW 5 106871820 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAACACATTGCCTGTCAGC -3'
(R):5'- AGGCAGGCGAATTTCTGAG -3'

Sequencing Primer
(F):5'- ACATTGCCTGTCAGCCACTG -3'
(R):5'- AATTTCTGAGTTTGAGGCCAGCC -3'
Posted On2014-09-17