Incidental Mutation 'R2122:Ppp1r3a'
ID 229569
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Name protein phosphatase 1, regulatory subunit 3A
Synonyms RGL, GM
MMRRC Submission 040126-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2122 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 14713976-14755273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 14721874 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 317 (N317K)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
AlphaFold Q99MR9
Predicted Effect possibly damaging
Transcript: ENSMUST00000045096
AA Change: N317K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: N317K

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G T 7: 120,119,184 (GRCm39) G975V probably damaging Het
Abcg5 T A 17: 84,978,575 (GRCm39) E294D probably benign Het
Actl10 G A 2: 154,394,153 (GRCm39) R35H probably damaging Het
Adamts12 C T 15: 11,310,665 (GRCm39) T974I probably damaging Het
Ahctf1 C A 1: 179,597,017 (GRCm39) R43L probably damaging Het
Arhgef10 A G 8: 14,984,820 (GRCm39) D200G probably damaging Het
Arhgef38 T C 3: 132,866,514 (GRCm39) K208E probably benign Het
Arhgef7 A T 8: 11,778,256 (GRCm39) N2I possibly damaging Het
Blvra T G 2: 126,928,817 (GRCm39) S102A probably damaging Het
Btn1a1 A G 13: 23,645,691 (GRCm39) L226P probably damaging Het
C2cd4d G T 3: 94,270,925 (GRCm39) E64* probably null Het
Ccna2 A G 3: 36,622,875 (GRCm39) V209A probably damaging Het
Cd55 T A 1: 130,387,354 (GRCm39) D148V possibly damaging Het
Cdh2 G A 18: 16,907,600 (GRCm39) P46L probably benign Het
Cldn11 A G 3: 31,217,300 (GRCm39) Y156C probably damaging Het
Cmtm2a T C 8: 105,019,655 (GRCm39) R12G possibly damaging Het
Cog2 T C 8: 125,255,724 (GRCm39) S104P possibly damaging Het
Col4a3 T G 1: 82,632,678 (GRCm39) F184V unknown Het
Col4a4 T A 1: 82,434,592 (GRCm39) D1406V unknown Het
Col6a1 T C 10: 76,557,332 (GRCm39) T207A probably benign Het
Cyp2a12 A G 7: 26,736,071 (GRCm39) *493W probably null Het
Dcdc2a T G 13: 25,303,268 (GRCm39) S266R possibly damaging Het
Dmd G C X: 83,356,089 (GRCm39) A2257P probably benign Het
Ecel1 A G 1: 87,075,997 (GRCm39) S727P probably damaging Het
Eif2ak4 T A 2: 118,286,274 (GRCm39) V1063E probably damaging Het
Enpp2 A T 15: 54,761,188 (GRCm39) Y44* probably null Het
Ep400 A T 5: 110,856,716 (GRCm39) probably benign Het
Exoc6b A G 6: 84,598,464 (GRCm39) M779T probably benign Het
F13a1 T A 13: 37,209,653 (GRCm39) Y104F probably benign Het
Fam78b G A 1: 166,906,278 (GRCm39) V146M probably damaging Het
Fgf18 A C 11: 33,068,003 (GRCm39) F129C probably damaging Het
Fscn3 A G 6: 28,430,388 (GRCm39) D186G probably benign Het
Gm5773 G A 3: 93,680,624 (GRCm39) G99R possibly damaging Het
Grk1 A T 8: 13,455,221 (GRCm39) Y35F probably benign Het
Heatr1 T C 13: 12,418,145 (GRCm39) V359A probably benign Het
Hfm1 A G 5: 107,044,121 (GRCm39) S567P probably damaging Het
Il1rap A T 16: 26,529,315 (GRCm39) H379L probably damaging Het
Kctd5 T C 17: 24,274,940 (GRCm39) T212A probably benign Het
Krtap5-5 A T 7: 141,783,240 (GRCm39) C137S unknown Het
Lrp2 T C 2: 69,314,051 (GRCm39) T2227A probably damaging Het
Ltbp1 T A 17: 75,617,154 (GRCm39) V1031E possibly damaging Het
Ltbr A G 6: 125,286,440 (GRCm39) S249P probably benign Het
Map1a T A 2: 121,129,927 (GRCm39) Y248N probably damaging Het
Mdc1 C T 17: 36,158,835 (GRCm39) A405V probably benign Het
Mfsd4b1 T C 10: 39,878,647 (GRCm39) K417E possibly damaging Het
Mroh2a T C 1: 88,184,476 (GRCm39) V1453A probably benign Het
Myh11 T C 16: 14,035,868 (GRCm39) E1027G probably damaging Het
Nudt6 A C 3: 37,466,554 (GRCm39) F80L probably benign Het
Nxph1 A G 6: 9,247,791 (GRCm39) K254R probably damaging Het
Obsl1 C T 1: 75,470,527 (GRCm39) R1043H probably benign Het
Or10a4 A T 7: 106,697,316 (GRCm39) I215F probably damaging Het
Pde6d A G 1: 86,473,524 (GRCm39) F91L probably benign Het
Phldb2 T A 16: 45,583,304 (GRCm39) I1065F probably damaging Het
Psmd1 T A 1: 86,006,422 (GRCm39) S263T possibly damaging Het
Pum1 C A 4: 130,396,581 (GRCm39) T112K possibly damaging Het
Rasgrp2 T A 19: 6,454,425 (GRCm39) M156K probably benign Het
Reg3a T C 6: 78,358,119 (GRCm39) C17R possibly damaging Het
Ripor2 A G 13: 24,897,701 (GRCm39) S800G probably damaging Het
Rnf168 T G 16: 32,097,036 (GRCm39) L37R probably damaging Het
Rnf31 A G 14: 55,833,654 (GRCm39) D554G probably damaging Het
Rpe T C 1: 66,754,387 (GRCm39) M153T probably damaging Het
Sacs A T 14: 61,449,765 (GRCm39) Q3937L probably damaging Het
Sap18 T A 14: 58,036,011 (GRCm39) S66T probably damaging Het
Slc20a1 T G 2: 129,041,739 (GRCm39) I34S possibly damaging Het
Slc25a30 A G 14: 76,007,658 (GRCm39) S116P possibly damaging Het
Speer4c1 T A 5: 15,919,115 (GRCm39) D29V possibly damaging Het
Stk40 C T 4: 126,022,640 (GRCm39) T138I probably benign Het
Susd3 A G 13: 49,384,626 (GRCm39) Y254H probably damaging Het
Tanc2 T C 11: 105,786,775 (GRCm39) L858P probably damaging Het
Tas2r106 A T 6: 131,655,317 (GRCm39) L178H probably damaging Het
Tfpt C T 7: 3,631,930 (GRCm39) R60Q probably damaging Het
Tmem44 T A 16: 30,366,262 (GRCm39) K55* probably null Het
Tnfsf9 A T 17: 57,414,316 (GRCm39) probably null Het
Ube3c T C 5: 29,824,604 (GRCm39) I543T probably benign Het
Ugt1a2 C A 1: 88,128,735 (GRCm39) S126Y possibly damaging Het
Vmn1r180 T A 7: 23,652,566 (GRCm39) L243Q probably damaging Het
Vmn2r15 A C 5: 109,434,322 (GRCm39) V794G probably damaging Het
Vmn2r24 A G 6: 123,792,353 (GRCm39) D560G possibly damaging Het
Wdr11 G A 7: 129,233,490 (GRCm39) C1028Y probably damaging Het
Zfp318 A G 17: 46,724,297 (GRCm39) D2100G probably benign Het
Zfyve16 A T 13: 92,655,991 (GRCm39) Y789* probably null Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14,755,083 (GRCm39) missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14,719,059 (GRCm39) missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14,718,407 (GRCm39) missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14,717,851 (GRCm39) missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14,718,608 (GRCm39) missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14,718,345 (GRCm39) missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14,754,810 (GRCm39) missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14,717,714 (GRCm39) missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14,718,599 (GRCm39) missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14,718,458 (GRCm39) missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14,719,761 (GRCm39) missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14,719,810 (GRCm39) missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14,722,064 (GRCm39) splice site probably benign
IGL03290:Ppp1r3a APN 6 14,754,771 (GRCm39) missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14,719,765 (GRCm39) missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14,717,776 (GRCm39) missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14,717,660 (GRCm39) missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14,754,516 (GRCm39) missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14,718,959 (GRCm39) missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14,754,717 (GRCm39) missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14,717,981 (GRCm39) missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14,754,993 (GRCm39) missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14,722,103 (GRCm39) missense probably benign 0.12
R2437:Ppp1r3a UTSW 6 14,718,322 (GRCm39) missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14,719,377 (GRCm39) missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14,719,413 (GRCm39) missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14,719,911 (GRCm39) missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14,719,780 (GRCm39) missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14,754,681 (GRCm39) missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14,718,992 (GRCm39) missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14,719,046 (GRCm39) missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14,754,680 (GRCm39) missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14,719,603 (GRCm39) missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14,719,417 (GRCm39) missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14,719,348 (GRCm39) missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14,719,762 (GRCm39) missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14,719,882 (GRCm39) missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14,718,983 (GRCm39) missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14,718,988 (GRCm39) missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14,719,339 (GRCm39) missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14,754,603 (GRCm39) missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14,718,430 (GRCm39) missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14,719,570 (GRCm39) missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14,718,980 (GRCm39) nonsense probably null
R6869:Ppp1r3a UTSW 6 14,754,825 (GRCm39) missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14,719,235 (GRCm39) missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14,719,190 (GRCm39) missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14,719,069 (GRCm39) missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14,718,749 (GRCm39) missense probably damaging 0.97
R7770:Ppp1r3a UTSW 6 14,754,977 (GRCm39) missense probably benign 0.06
R7856:Ppp1r3a UTSW 6 14,718,025 (GRCm39) missense probably benign 0.01
R8309:Ppp1r3a UTSW 6 14,719,700 (GRCm39) missense probably benign 0.02
R8422:Ppp1r3a UTSW 6 14,718,434 (GRCm39) nonsense probably null
R8868:Ppp1r3a UTSW 6 14,755,014 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r3a UTSW 6 14,754,525 (GRCm39) missense probably damaging 1.00
R9149:Ppp1r3a UTSW 6 14,722,098 (GRCm39) missense probably benign 0.32
R9302:Ppp1r3a UTSW 6 14,721,891 (GRCm39) missense probably benign 0.00
R9399:Ppp1r3a UTSW 6 14,755,010 (GRCm39) missense probably damaging 0.99
R9565:Ppp1r3a UTSW 6 14,719,466 (GRCm39) missense probably benign 0.02
R9730:Ppp1r3a UTSW 6 14,721,923 (GRCm39) missense probably benign 0.25
R9767:Ppp1r3a UTSW 6 14,718,101 (GRCm39) missense probably benign 0.03
R9782:Ppp1r3a UTSW 6 14,718,766 (GRCm39) missense probably damaging 1.00
Z1177:Ppp1r3a UTSW 6 14,755,150 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TCAAGCTAGATGGAGATGCTG -3'
(R):5'- GAACCATTGCTAGCACCAGAAG -3'

Sequencing Primer
(F):5'- TGGGACAGAGTAAGCCATGC -3'
(R):5'- GCTAGCACCAGAAGAAAATAAATTTG -3'
Posted On 2014-09-17