Incidental Mutation 'R2122:Abca16'
ID229581
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene NameATP-binding cassette, sub-family A (ABC1), member 16
Synonyms
MMRRC Submission 040126-MU
Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2122 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location120409647-120544813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120519961 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 975 (G975V)
Ref Sequence ENSEMBL: ENSMUSP00000061094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
AlphaFold E9PWJ7
Predicted Effect probably damaging
Transcript: ENSMUST00000056042
AA Change: G975V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: G975V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120490
AA Change: G976V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: G976V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Actl10 G A 2: 154,552,233 R35H probably damaging Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Arhgef7 A T 8: 11,728,256 N2I possibly damaging Het
Blvra T G 2: 127,086,897 S102A probably damaging Het
Btn1a1 A G 13: 23,461,521 L226P probably damaging Het
C2cd4d G T 3: 94,363,618 E64* probably null Het
Ccna2 A G 3: 36,568,726 V209A probably damaging Het
Cd55 T A 1: 130,459,617 D148V possibly damaging Het
Cdh2 G A 18: 16,774,543 P46L probably benign Het
Cldn11 A G 3: 31,163,151 Y156C probably damaging Het
Cmtm2a T C 8: 104,293,023 R12G possibly damaging Het
Cog2 T C 8: 124,528,985 S104P possibly damaging Het
Col4a3 T G 1: 82,654,957 F184V unknown Het
Col4a4 T A 1: 82,456,871 D1406V unknown Het
Col6a1 T C 10: 76,721,498 T207A probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dcdc2a T G 13: 25,119,285 S266R possibly damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Eif2ak4 T A 2: 118,455,793 V1063E probably damaging Het
Enpp2 A T 15: 54,897,792 Y44* probably null Het
Ep400 A T 5: 110,708,850 probably benign Het
Exoc6b A G 6: 84,621,482 M779T probably benign Het
F13a1 T A 13: 37,025,679 Y104F probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Fscn3 A G 6: 28,430,389 D186G probably benign Het
Gm5773 G A 3: 93,773,317 G99R possibly damaging Het
Grk1 A T 8: 13,405,221 Y35F probably benign Het
Heatr1 T C 13: 12,403,264 V359A probably benign Het
Hfm1 A G 5: 106,896,255 S567P probably damaging Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Kctd5 T C 17: 24,055,966 T212A probably benign Het
Krtap5-5 A T 7: 142,229,503 C137S unknown Het
Lrp2 T C 2: 69,483,707 T2227A probably damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Map1a T A 2: 121,299,446 Y248N probably damaging Het
Mdc1 C T 17: 35,847,943 A405V probably benign Het
Mfsd4b1 T C 10: 40,002,651 K417E possibly damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh11 T C 16: 14,218,004 E1027G probably damaging Het
Nudt6 A C 3: 37,412,405 F80L probably benign Het
Nxph1 A G 6: 9,247,791 K254R probably damaging Het
Obsl1 C T 1: 75,493,883 R1043H probably benign Het
Olfr17 A T 7: 107,098,109 I215F probably damaging Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Phldb2 T A 16: 45,762,941 I1065F probably damaging Het
Ppp1r3a A T 6: 14,721,875 N317K possibly damaging Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reg3a T C 6: 78,381,136 C17R possibly damaging Het
Ripor2 A G 13: 24,713,718 S800G probably damaging Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
Rnf31 A G 14: 55,596,197 D554G probably damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sacs A T 14: 61,212,316 Q3937L probably damaging Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Slc20a1 T G 2: 129,199,819 I34S possibly damaging Het
Slc25a30 A G 14: 75,770,218 S116P possibly damaging Het
Speer4c T A 5: 15,714,117 D29V possibly damaging Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Susd3 A G 13: 49,231,150 Y254H probably damaging Het
Tanc2 T C 11: 105,895,949 L858P probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tfpt C T 7: 3,628,931 R60Q probably damaging Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Tnfsf9 A T 17: 57,107,316 probably null Het
Ube3c T C 5: 29,619,606 I543T probably benign Het
Ugt1a2 C A 1: 88,201,013 S126Y possibly damaging Het
Vmn1r180 T A 7: 23,953,141 L243Q probably damaging Het
Vmn2r15 A C 5: 109,286,456 V794G probably damaging Het
Vmn2r24 A G 6: 123,815,394 D560G possibly damaging Het
Wdr11 G A 7: 129,631,766 C1028Y probably damaging Het
Zfp318 A G 17: 46,413,371 D2100G probably benign Het
Zfyve16 A T 13: 92,519,483 Y789* probably null Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120423759 missense probably benign 0.08
IGL00590:Abca16 APN 7 120423815 missense probably damaging 1.00
IGL01320:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01322:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01613:Abca16 APN 7 120541277 missense probably benign 0.03
IGL01774:Abca16 APN 7 120477835 missense probably damaging 1.00
IGL01774:Abca16 APN 7 120421801 splice site probably benign
IGL01797:Abca16 APN 7 120514537 missense probably benign 0.15
IGL02406:Abca16 APN 7 120540602 missense probably damaging 1.00
IGL02437:Abca16 APN 7 120533729 missense probably benign 0.00
IGL02541:Abca16 APN 7 120514658 missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120433455 missense probably benign 0.05
IGL02578:Abca16 APN 7 120423956 critical splice donor site probably null
IGL03156:Abca16 APN 7 120423851 missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120527818 missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120540128 missense probably benign 0.31
R0024:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0123:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0134:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0225:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0346:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R0355:Abca16 UTSW 7 120423798 missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120544716 missense probably benign 0.01
R0525:Abca16 UTSW 7 120465810 nonsense probably null
R0617:Abca16 UTSW 7 120433611 splice site probably benign
R0625:Abca16 UTSW 7 120435893 missense probably damaging 1.00
R0835:Abca16 UTSW 7 120465784 missense probably benign 0.42
R1445:Abca16 UTSW 7 120520033 missense probably benign 0.41
R1535:Abca16 UTSW 7 120540705 missense probably benign 0.30
R1567:Abca16 UTSW 7 120431129 missense probably benign 0.08
R1694:Abca16 UTSW 7 120520084 missense probably damaging 1.00
R1860:Abca16 UTSW 7 120534763 missense probably benign 0.02
R1876:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R1913:Abca16 UTSW 7 120541240 missense probably benign 0.04
R1940:Abca16 UTSW 7 120433609 splice site probably benign
R2042:Abca16 UTSW 7 120544718 missense probably benign
R2115:Abca16 UTSW 7 120540645 missense probably damaging 1.00
R2265:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2267:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2269:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2993:Abca16 UTSW 7 120535161 missense probably damaging 1.00
R3055:Abca16 UTSW 7 120435851 missense probably benign 0.05
R3956:Abca16 UTSW 7 120527752 missense probably damaging 0.96
R4114:Abca16 UTSW 7 120527067 missense probably benign 0.06
R4441:Abca16 UTSW 7 120527801 missense probably benign 0.04
R4601:Abca16 UTSW 7 120436697 missense probably damaging 0.98
R4706:Abca16 UTSW 7 120465765 missense probably damaging 1.00
R4807:Abca16 UTSW 7 120540609 missense probably damaging 1.00
R4824:Abca16 UTSW 7 120475479 missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120527086 missense probably damaging 0.98
R5152:Abca16 UTSW 7 120540623 missense probably benign 0.02
R5257:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5258:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5330:Abca16 UTSW 7 120503377 missense probably benign 0.15
R5388:Abca16 UTSW 7 120540746 critical splice donor site probably null
R5590:Abca16 UTSW 7 120544772 missense probably damaging 0.98
R5810:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6161:Abca16 UTSW 7 120540711 missense probably damaging 1.00
R6313:Abca16 UTSW 7 120527121 missense probably damaging 1.00
R6485:Abca16 UTSW 7 120427167 nonsense probably null
R6527:Abca16 UTSW 7 120477772 missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120527053 missense probably damaging 1.00
R6885:Abca16 UTSW 7 120520109 missense probably benign 0.07
R6899:Abca16 UTSW 7 120527041 missense probably damaging 1.00
R6941:Abca16 UTSW 7 120541147 missense probably damaging 1.00
R6990:Abca16 UTSW 7 120527727 missense probably benign 0.00
R7059:Abca16 UTSW 7 120421748 missense probably benign 0.00
R7144:Abca16 UTSW 7 120433573 missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120527751 missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120427186 missense probably damaging 1.00
R7308:Abca16 UTSW 7 120423770 missense probably benign 0.01
R7449:Abca16 UTSW 7 120435908 missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120519988 missense probably benign 0.11
R7617:Abca16 UTSW 7 120503471 nonsense probably null
R7646:Abca16 UTSW 7 120514714 missense probably benign 0.04
R7750:Abca16 UTSW 7 120514705 missense probably benign 0.09
R7763:Abca16 UTSW 7 120514602 missense probably damaging 1.00
R7840:Abca16 UTSW 7 120475466 missense probably benign 0.00
R7946:Abca16 UTSW 7 120527175 missense probably benign 0.01
R8018:Abca16 UTSW 7 120533643 missense probably benign 0.04
R8170:Abca16 UTSW 7 120465782 missense probably damaging 1.00
R8413:Abca16 UTSW 7 120423900 missense probably benign 0.06
R8461:Abca16 UTSW 7 120436695 missense possibly damaging 0.95
R8858:Abca16 UTSW 7 120453104 missense probably benign
R8881:Abca16 UTSW 7 120475571 missense probably benign 0.18
RF020:Abca16 UTSW 7 120533657 missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120503386 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGGCTGAAACAGGACCTC -3'
(R):5'- CATCAGGGCCAGAAAGTGTC -3'

Sequencing Primer
(F):5'- ATTCCAGCACTTGGGGAATC -3'
(R):5'- TCAGGGCCAGAAAGTGTCATAAAAAG -3'
Posted On2014-09-17