Incidental Mutation 'R2122:Mdc1'
ID229617
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Namemediator of DNA damage checkpoint 1
SynonymsNFBD1
MMRRC Submission 040126-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R2122 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35841515-35859670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35847943 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 405 (A405V)
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337] [ENSMUST00000174124]
Predicted Effect probably benign
Transcript: ENSMUST00000082337
AA Change: A405V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: A405V

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174124
SMART Domains Protein: ENSMUSP00000133568
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225192
Meta Mutation Damage Score 0.0844 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G T 7: 120,519,961 G975V probably damaging Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Actl10 G A 2: 154,552,233 R35H probably damaging Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Arhgef7 A T 8: 11,728,256 N2I possibly damaging Het
Blvra T G 2: 127,086,897 S102A probably damaging Het
Btn1a1 A G 13: 23,461,521 L226P probably damaging Het
C2cd4d G T 3: 94,363,618 E64* probably null Het
Ccna2 A G 3: 36,568,726 V209A probably damaging Het
Cd55 T A 1: 130,459,617 D148V possibly damaging Het
Cdh2 G A 18: 16,774,543 P46L probably benign Het
Cldn11 A G 3: 31,163,151 Y156C probably damaging Het
Cmtm2a T C 8: 104,293,023 R12G possibly damaging Het
Cog2 T C 8: 124,528,985 S104P possibly damaging Het
Col4a3 T G 1: 82,654,957 F184V unknown Het
Col4a4 T A 1: 82,456,871 D1406V unknown Het
Col6a1 T C 10: 76,721,498 T207A probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dcdc2a T G 13: 25,119,285 S266R possibly damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Eif2ak4 T A 2: 118,455,793 V1063E probably damaging Het
Enpp2 A T 15: 54,897,792 Y44* probably null Het
Ep400 A T 5: 110,708,850 probably benign Het
Exoc6b A G 6: 84,621,482 M779T probably benign Het
F13a1 T A 13: 37,025,679 Y104F probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Fscn3 A G 6: 28,430,389 D186G probably benign Het
Gm5773 G A 3: 93,773,317 G99R possibly damaging Het
Grk1 A T 8: 13,405,221 Y35F probably benign Het
Heatr1 T C 13: 12,403,264 V359A probably benign Het
Hfm1 A G 5: 106,896,255 S567P probably damaging Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Kctd5 T C 17: 24,055,966 T212A probably benign Het
Krtap5-5 A T 7: 142,229,503 C137S unknown Het
Lrp2 T C 2: 69,483,707 T2227A probably damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Map1a T A 2: 121,299,446 Y248N probably damaging Het
Mfsd4b1 T C 10: 40,002,651 K417E possibly damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh11 T C 16: 14,218,004 E1027G probably damaging Het
Nudt6 A C 3: 37,412,405 F80L probably benign Het
Nxph1 A G 6: 9,247,791 K254R probably damaging Het
Obsl1 C T 1: 75,493,883 R1043H probably benign Het
Olfr17 A T 7: 107,098,109 I215F probably damaging Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Phldb2 T A 16: 45,762,941 I1065F probably damaging Het
Ppp1r3a A T 6: 14,721,875 N317K possibly damaging Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reg3a T C 6: 78,381,136 C17R possibly damaging Het
Ripor2 A G 13: 24,713,718 S800G probably damaging Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
Rnf31 A G 14: 55,596,197 D554G probably damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sacs A T 14: 61,212,316 Q3937L probably damaging Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Slc20a1 T G 2: 129,199,819 I34S possibly damaging Het
Slc25a30 A G 14: 75,770,218 S116P possibly damaging Het
Speer4c T A 5: 15,714,117 D29V possibly damaging Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Susd3 A G 13: 49,231,150 Y254H probably damaging Het
Tanc2 T C 11: 105,895,949 L858P probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tfpt C T 7: 3,628,931 R60Q probably damaging Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Tnfsf9 A T 17: 57,107,316 probably null Het
Ube3c T C 5: 29,619,606 I543T probably benign Het
Ugt1a2 C A 1: 88,201,013 S126Y possibly damaging Het
Vmn1r180 T A 7: 23,953,141 L243Q probably damaging Het
Vmn2r15 A C 5: 109,286,456 V794G probably damaging Het
Vmn2r24 A G 6: 123,815,394 D560G possibly damaging Het
Wdr11 G A 7: 129,631,766 C1028Y probably damaging Het
Zfp318 A G 17: 46,413,371 D2100G probably benign Het
Zfyve16 A T 13: 92,519,483 Y789* probably null Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 35848020 missense probably benign 0.04
IGL01662:Mdc1 APN 17 35852505 missense probably benign 0.00
IGL01931:Mdc1 APN 17 35848231 missense probably benign 0.00
IGL02542:Mdc1 APN 17 35853156 missense probably damaging 0.96
IGL02823:Mdc1 APN 17 35852923 missense probably damaging 0.99
IGL03411:Mdc1 APN 17 35853126 missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 35846191 missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 35844469 missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 35849033 missense probably benign 0.00
R0129:Mdc1 UTSW 17 35854445 missense probably benign 0.04
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0132:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1597:Mdc1 UTSW 17 35845866 missense probably damaging 1.00
R1721:Mdc1 UTSW 17 35847826 missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1912:Mdc1 UTSW 17 35844538 missense probably benign 0.00
R1912:Mdc1 UTSW 17 35850811 missense probably benign 0.19
R1977:Mdc1 UTSW 17 35850930 missense probably benign 0.01
R2121:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2357:Mdc1 UTSW 17 35847445 missense probably benign 0.00
R2842:Mdc1 UTSW 17 35848794 missense probably benign 0.01
R2851:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2852:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2964:Mdc1 UTSW 17 35853637 missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 35847893 unclassified probably benign
R3752:Mdc1 UTSW 17 35845929 missense probably damaging 1.00
R4234:Mdc1 UTSW 17 35848824 missense probably benign 0.00
R4641:Mdc1 UTSW 17 35857469 missense probably benign 0.09
R4706:Mdc1 UTSW 17 35852779 missense probably damaging 0.99
R4809:Mdc1 UTSW 17 35849101 critical splice donor site probably null
R4833:Mdc1 UTSW 17 35850394 missense probably benign 0.20
R5032:Mdc1 UTSW 17 35850589 missense probably benign 0.00
R5047:Mdc1 UTSW 17 35847844 missense probably benign 0.00
R5086:Mdc1 UTSW 17 35848630 missense probably benign 0.00
R5172:Mdc1 UTSW 17 35853090 missense probably benign 0.00
R5254:Mdc1 UTSW 17 35847922 missense probably benign 0.00
R5473:Mdc1 UTSW 17 35848060 missense probably benign 0.01
R5550:Mdc1 UTSW 17 35845884 missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 35848546 missense probably benign 0.00
R5888:Mdc1 UTSW 17 35847820 missense probably benign 0.01
R6020:Mdc1 UTSW 17 35848633 missense probably benign 0.04
R6020:Mdc1 UTSW 17 35857572 missense probably benign 0.01
R6219:Mdc1 UTSW 17 35850674 missense probably benign 0.10
R7053:Mdc1 UTSW 17 35846326 missense probably benign 0.00
R7073:Mdc1 UTSW 17 35854068 missense probably benign 0.18
R7077:Mdc1 UTSW 17 35845947 missense probably damaging 0.97
R7424:Mdc1 UTSW 17 35853309 missense probably benign 0.04
R7443:Mdc1 UTSW 17 35850820 missense probably damaging 0.98
R7467:Mdc1 UTSW 17 35844556 missense probably benign 0.29
R7549:Mdc1 UTSW 17 35848857 missense probably null 0.04
R7655:Mdc1 UTSW 17 35850881 missense probably benign 0.01
R7656:Mdc1 UTSW 17 35850881 missense probably benign 0.01
RF025:Mdc1 UTSW 17 35854407 critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 35850937 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATCCTGAAGCACCTGGTG -3'
(R):5'- TCTGCATCATTGGGCCTACG -3'

Sequencing Primer
(F):5'- TGTGGCACATCTGCAGGACTG -3'
(R):5'- CTGTGTGACAGTAAGAGCCTCATC -3'
Posted On2014-09-17