Incidental Mutation 'R2122:Tnfsf9'
ID229619
Institutional Source Beutler Lab
Gene Symbol Tnfsf9
Ensembl Gene ENSMUSG00000035678
Gene Nametumor necrosis factor (ligand) superfamily, member 9
SynonymsCd137l, Ly63l, 4-1BB-L, 4-1BBL, 4-1BB ligand
MMRRC Submission 040126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R2122 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57105385-57107757 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 57107316 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039490] [ENSMUST00000112915]
Predicted Effect probably benign
Transcript: ENSMUST00000039490
AA Change: M248L

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040412
Gene: ENSMUSG00000035678
AA Change: M248L

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
TNF 147 302 1.16e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112915
SMART Domains Protein: ENSMUSP00000108537
Gene: ENSMUSG00000079414

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased susceptibility to viral infection and defective memory T cell activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G T 7: 120,519,961 G975V probably damaging Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Actl10 G A 2: 154,552,233 R35H probably damaging Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Arhgef7 A T 8: 11,728,256 N2I possibly damaging Het
Blvra T G 2: 127,086,897 S102A probably damaging Het
Btn1a1 A G 13: 23,461,521 L226P probably damaging Het
C2cd4d G T 3: 94,363,618 E64* probably null Het
Ccna2 A G 3: 36,568,726 V209A probably damaging Het
Cd55 T A 1: 130,459,617 D148V possibly damaging Het
Cdh2 G A 18: 16,774,543 P46L probably benign Het
Cldn11 A G 3: 31,163,151 Y156C probably damaging Het
Cmtm2a T C 8: 104,293,023 R12G possibly damaging Het
Cog2 T C 8: 124,528,985 S104P possibly damaging Het
Col4a3 T G 1: 82,654,957 F184V unknown Het
Col4a4 T A 1: 82,456,871 D1406V unknown Het
Col6a1 T C 10: 76,721,498 T207A probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dcdc2a T G 13: 25,119,285 S266R possibly damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Eif2ak4 T A 2: 118,455,793 V1063E probably damaging Het
Enpp2 A T 15: 54,897,792 Y44* probably null Het
Ep400 A T 5: 110,708,850 probably benign Het
Exoc6b A G 6: 84,621,482 M779T probably benign Het
F13a1 T A 13: 37,025,679 Y104F probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Fscn3 A G 6: 28,430,389 D186G probably benign Het
Gm5773 G A 3: 93,773,317 G99R possibly damaging Het
Grk1 A T 8: 13,405,221 Y35F probably benign Het
Heatr1 T C 13: 12,403,264 V359A probably benign Het
Hfm1 A G 5: 106,896,255 S567P probably damaging Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Kctd5 T C 17: 24,055,966 T212A probably benign Het
Krtap5-5 A T 7: 142,229,503 C137S unknown Het
Lrp2 T C 2: 69,483,707 T2227A probably damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Map1a T A 2: 121,299,446 Y248N probably damaging Het
Mdc1 C T 17: 35,847,943 A405V probably benign Het
Mfsd4b1 T C 10: 40,002,651 K417E possibly damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh11 T C 16: 14,218,004 E1027G probably damaging Het
Nudt6 A C 3: 37,412,405 F80L probably benign Het
Nxph1 A G 6: 9,247,791 K254R probably damaging Het
Obsl1 C T 1: 75,493,883 R1043H probably benign Het
Olfr17 A T 7: 107,098,109 I215F probably damaging Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Phldb2 T A 16: 45,762,941 I1065F probably damaging Het
Ppp1r3a A T 6: 14,721,875 N317K possibly damaging Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reg3a T C 6: 78,381,136 C17R possibly damaging Het
Ripor2 A G 13: 24,713,718 S800G probably damaging Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
Rnf31 A G 14: 55,596,197 D554G probably damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sacs A T 14: 61,212,316 Q3937L probably damaging Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Slc20a1 T G 2: 129,199,819 I34S possibly damaging Het
Slc25a30 A G 14: 75,770,218 S116P possibly damaging Het
Speer4c T A 5: 15,714,117 D29V possibly damaging Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Susd3 A G 13: 49,231,150 Y254H probably damaging Het
Tanc2 T C 11: 105,895,949 L858P probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tfpt C T 7: 3,628,931 R60Q probably damaging Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Ube3c T C 5: 29,619,606 I543T probably benign Het
Ugt1a2 C A 1: 88,201,013 S126Y possibly damaging Het
Vmn1r180 T A 7: 23,953,141 L243Q probably damaging Het
Vmn2r15 A C 5: 109,286,456 V794G probably damaging Het
Vmn2r24 A G 6: 123,815,394 D560G possibly damaging Het
Wdr11 G A 7: 129,631,766 C1028Y probably damaging Het
Zfp318 A G 17: 46,413,371 D2100G probably benign Het
Zfyve16 A T 13: 92,519,483 Y789* probably null Het
Other mutations in Tnfsf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Tnfsf9 APN 17 57107335 missense possibly damaging 0.77
PIT4445001:Tnfsf9 UTSW 17 57105517 missense possibly damaging 0.96
R0005:Tnfsf9 UTSW 17 57107236 missense possibly damaging 0.92
R1823:Tnfsf9 UTSW 17 57105738 missense probably benign 0.03
R1824:Tnfsf9 UTSW 17 57105738 missense probably benign 0.03
R4880:Tnfsf9 UTSW 17 57105433 start codon destroyed probably null 0.02
R4982:Tnfsf9 UTSW 17 57107504 makesense probably null
R5057:Tnfsf9 UTSW 17 57105444 missense probably benign
R5166:Tnfsf9 UTSW 17 57106263 missense possibly damaging 0.85
R5395:Tnfsf9 UTSW 17 57105592 missense probably benign 0.44
R6823:Tnfsf9 UTSW 17 57105513 missense probably benign 0.00
R7023:Tnfsf9 UTSW 17 57107317 missense possibly damaging 0.71
R7514:Tnfsf9 UTSW 17 57107238 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGGAGCTCATACCTATCTCAAG -3'
(R):5'- TGTCGGGTTTCACAAGAAAGAG -3'

Sequencing Primer
(F):5'- CTCAAGGTCTGAGGTACGAAG -3'
(R):5'- TTTCACAAGAAAGAGTCCAAAGCTG -3'
Posted On2014-09-17