Incidental Mutation 'R2124:Dstyk'
ID229628
Institutional Source Beutler Lab
Gene Symbol Dstyk
Ensembl Gene ENSMUSG00000042046
Gene Namedual serine/threonine and tyrosine protein kinase
SynonymsC430014H23Rik, A930019K20Rik
MMRRC Submission 040127-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R2124 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132417555-132466958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132453119 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 451 (G451R)
Ref Sequence ENSEMBL: ENSMUSP00000139652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045110] [ENSMUST00000188389]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045110
AA Change: G451R

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035358
Gene: ENSMUSG00000042046
AA Change: G451R

DomainStartEndE-ValueType
low complexity region 15 22 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
Pfam:Pkinase_Tyr 651 904 6.9e-37 PFAM
Pfam:Pkinase 651 905 5.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188006
Predicted Effect possibly damaging
Transcript: ENSMUST00000188389
AA Change: G451R

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139652
Gene: ENSMUSG00000042046
AA Change: G451R

DomainStartEndE-ValueType
low complexity region 15 22 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
S_TKc 650 859 2e-13 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual serine/threonine and tyrosine protein kinase which is expressed in multiple tissues. It is thought to function as a regulator of cell death. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous knockout results in impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Adgrg6 T C 10: 14,467,186 D339G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap3 A C 18: 37,973,350 L1480R probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Aspg G A 12: 112,121,174 V8I probably benign Het
Aven T A 2: 112,625,196 W26R probably damaging Het
Car4 T A 11: 84,964,085 probably benign Het
Cd163 C T 6: 124,318,856 R720C probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Cdh3 A T 8: 106,552,888 H712L probably damaging Het
Cdr2 T C 7: 120,982,027 E9G probably damaging Het
Chrnb2 T C 3: 89,769,341 probably benign Het
Col4a2 C A 8: 11,416,070 P443Q probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Ddias T C 7: 92,858,256 Q817R probably benign Het
Ddx6 C T 9: 44,624,519 Q182* probably null Het
Dhrs7 A G 12: 72,653,177 I227T probably damaging Het
Dhx8 A T 11: 101,762,245 M970L probably damaging Het
Dnah7a A T 1: 53,496,942 D2647E possibly damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Efl1 C T 7: 82,692,913 R510C probably damaging Het
Eif4g3 A G 4: 138,184,742 E1409G probably damaging Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fcgbp T C 7: 28,092,019 Y902H probably benign Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gbp9 T A 5: 105,094,543 D110V probably damaging Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm10542 T A 18: 44,201,288 W9R probably null Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Gpaa1 A G 15: 76,333,352 Y330C probably damaging Het
Hectd4 T C 5: 121,318,639 L689P probably damaging Het
Hoxd3 C A 2: 74,744,234 P75T possibly damaging Het
Ikbkb A G 8: 22,666,020 L570P probably damaging Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Kidins220 G A 12: 25,041,303 probably null Het
Kif1b T C 4: 149,222,296 D869G probably benign Het
Loxl2 T C 14: 69,692,410 Y746H probably benign Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Msantd2 C T 9: 37,522,931 R357W probably damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Olfr866 T G 9: 20,027,501 I146L probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prkdc T C 16: 15,719,433 V1716A probably benign Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Rims1 T A 1: 22,404,508 R200* probably null Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
Sall3 C T 18: 80,971,797 G972D probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Sdk1 C A 5: 142,185,188 D1935E possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt16 T A 12: 74,238,235 S401T probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tbcd A G 11: 121,603,320 Y983C probably damaging Het
Tenm3 A G 8: 48,417,006 probably null Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Top2a T C 11: 99,004,228 I849V probably benign Het
Ttn A G 2: 76,794,448 V13516A probably damaging Het
Uxs1 A G 1: 43,774,846 L77P probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vmn2r84 A C 10: 130,391,231 M246R probably damaging Het
Vps13b T A 15: 35,646,080 N1443K probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp616 A G 11: 74,083,043 probably null Het
Zmym1 T C 4: 127,049,570 T244A probably benign Het
Other mutations in Dstyk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Dstyk APN 1 132459988 missense probably damaging 1.00
IGL01753:Dstyk APN 1 132462939 missense probably damaging 1.00
IGL02156:Dstyk APN 1 132449926 missense probably benign 0.27
IGL02175:Dstyk APN 1 132449391 nonsense probably null
IGL02721:Dstyk APN 1 132449316 missense probably benign 0.03
IGL03194:Dstyk APN 1 132456316 splice site probably benign
PIT4305001:Dstyk UTSW 1 132455896 nonsense probably null
PIT4791001:Dstyk UTSW 1 132449927 missense probably benign 0.00
R0135:Dstyk UTSW 1 132462934 missense probably damaging 1.00
R0309:Dstyk UTSW 1 132456864 splice site probably benign
R0399:Dstyk UTSW 1 132453080 splice site probably benign
R0781:Dstyk UTSW 1 132453325 splice site probably benign
R1110:Dstyk UTSW 1 132453325 splice site probably benign
R1138:Dstyk UTSW 1 132463486 missense probably benign 0.00
R1300:Dstyk UTSW 1 132449913 missense probably benign 0.02
R1330:Dstyk UTSW 1 132449880 missense probably benign 0.25
R1509:Dstyk UTSW 1 132456346 missense probably damaging 1.00
R1667:Dstyk UTSW 1 132456919 missense probably damaging 1.00
R1728:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1729:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1730:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1739:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1757:Dstyk UTSW 1 132434094 splice site probably benign
R1762:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1783:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1784:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1785:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1829:Dstyk UTSW 1 132449595 missense probably benign 0.06
R2031:Dstyk UTSW 1 132453191 missense probably damaging 0.99
R2132:Dstyk UTSW 1 132449484 missense probably null
R2143:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R2144:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R2145:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R3804:Dstyk UTSW 1 132449726 missense probably damaging 1.00
R4277:Dstyk UTSW 1 132455413 splice site probably null
R4504:Dstyk UTSW 1 132434389 missense possibly damaging 0.81
R4674:Dstyk UTSW 1 132463390 missense probably benign 0.42
R4697:Dstyk UTSW 1 132449487 missense probably damaging 0.98
R4828:Dstyk UTSW 1 132434137 missense probably benign
R4940:Dstyk UTSW 1 132453106 missense probably damaging 0.96
R5029:Dstyk UTSW 1 132449324 missense probably benign 0.01
R5678:Dstyk UTSW 1 132453291 missense probably benign
R5900:Dstyk UTSW 1 132456979 missense probably damaging 1.00
R5935:Dstyk UTSW 1 132454137 missense probably damaging 0.99
R5973:Dstyk UTSW 1 132434411 missense probably damaging 0.99
R6217:Dstyk UTSW 1 132459939 missense probably damaging 1.00
R6381:Dstyk UTSW 1 132456765 intron probably null
R6429:Dstyk UTSW 1 132449804 nonsense probably null
R7038:Dstyk UTSW 1 132454109 missense probably benign 0.32
R7240:Dstyk UTSW 1 132454123 missense probably benign 0.02
R7411:Dstyk UTSW 1 132417666 missense probably benign 0.01
R7714:Dstyk UTSW 1 132456876 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GATTCAGAATTTGACAGCCAACC -3'
(R):5'- CACAGTGTCTTAGCAACCATTC -3'

Sequencing Primer
(F):5'- GACAGCCAACCATATCTTTTCATAG -3'
(R):5'- CACACCTGTTTGAGATAGTTGC -3'
Posted On2014-09-17