Incidental Mutation 'R0158:Cdkn2a'
ID22963
Institutional Source Beutler Lab
Gene Symbol Cdkn2a
Ensembl Gene ENSMUSG00000044303
Gene Namecyclin dependent kinase inhibitor 2A
Synonymsp16, Ink4a/Arf, p19, MTS1, p19ARF, Pctr1, p16INK4a, ARF-INK4a, Arf, INK4a-ARF
MMRRC Submission 038438-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0158 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location89274471-89294653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89276767 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 115 (H115Q)
Ref Sequence ENSEMBL: ENSMUSP00000061847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060501] [ENSMUST00000107131]
PDB Structure
[]
Predicted Effect probably benign
Transcript: ENSMUST00000030237
AA Change: S137T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030237
Gene: ENSMUSG00000044303
AA Change: S137T

DomainStartEndE-ValueType
Pfam:P19Arf_N 4 54 4.6e-26 PFAM
low complexity region 70 76 N/A INTRINSIC
low complexity region 105 121 N/A INTRINSIC
transmembrane domain 142 159 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000060501
AA Change: H115Q

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061847
Gene: ENSMUSG00000044303
AA Change: H115Q

DomainStartEndE-ValueType
ANK 3 32 1.53e3 SMART
ANK 36 64 4.07e-1 SMART
ANK 69 98 4.44e2 SMART
ANK 102 131 1.01e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107131
AA Change: S137T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102748
Gene: ENSMUSG00000044303
AA Change: S137T

DomainStartEndE-ValueType
Blast:ANK 1 21 2e-6 BLAST
ANK 26 55 2.8e0 SMART
ANK 59 88 6.3e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129527
Meta Mutation Damage Score 0.2315 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 93% (79/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012]
PHENOTYPE: Null mutants of p16INK4a or p19ARF proteins each show increased tumor susceptibility and sensitivity to carcinogens. Loss of both gives very early onset. p19ARF nulls also show thymic hyperplasia and the eye's hyaloid vascular system fails to regress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T G 1: 26,683,951 H716P probably damaging Het
9530053A07Rik A G 7: 28,155,492 I1848V probably damaging Het
Abcf3 C T 16: 20,552,566 R437C probably damaging Het
Abhd3 A G 18: 10,647,840 Y315H possibly damaging Het
Adam19 C T 11: 46,143,034 P891L probably damaging Het
Ampd1 T A 3: 103,091,730 Y400* probably null Het
Ap1g1 T C 8: 109,855,635 S724P probably benign Het
BC067074 T A 13: 113,369,153 L2272* probably null Het
Bst2 T A 8: 71,537,217 T71S possibly damaging Het
C3 A G 17: 57,224,851 probably null Het
Cacna2d1 C A 5: 16,361,817 probably benign Het
Cacna2d4 C T 6: 119,236,748 H43Y possibly damaging Het
Ccdc71 T G 9: 108,464,137 V383G probably benign Het
Cd109 A T 9: 78,688,932 Q849L possibly damaging Het
Ces1e T C 8: 93,219,429 E161G probably benign Het
Cggbp1 C T 16: 64,855,838 S89L possibly damaging Het
Crocc A T 4: 141,042,242 probably benign Het
Eef1akmt3 G A 10: 127,033,273 Q111* probably null Het
Exoc7 T C 11: 116,295,292 N361S probably benign Het
Fat2 G T 11: 55,296,185 S1278R probably benign Het
Fbxo42 A G 4: 141,200,329 N640S probably benign Het
Fbxw25 A G 9: 109,654,652 V164A possibly damaging Het
Foxs1 T C 2: 152,932,410 E241G probably damaging Het
Fras1 A T 5: 96,776,634 I3645F possibly damaging Het
Gm14496 T A 2: 181,997,413 V432E probably benign Het
Herc1 T A 9: 66,495,921 L4374* probably null Het
Hist1h3b T A 13: 23,752,710 C111S probably damaging Het
Ift122 T C 6: 115,924,484 probably benign Het
Itgav C A 2: 83,792,037 N654K probably benign Het
Itih5 T C 2: 10,234,992 probably benign Het
Jak2 C A 19: 29,311,757 T1103K probably benign Het
Kcnc4 C A 3: 107,458,604 C96F probably benign Het
Med13l C A 5: 118,742,449 S1202Y unknown Het
Mefv T C 16: 3,715,456 E317G possibly damaging Het
Ncoa2 T C 1: 13,152,384 T1226A probably benign Het
Nktr C T 9: 121,750,691 probably benign Het
Nudt5 G A 2: 5,862,303 V61M probably damaging Het
Olfr33 C T 7: 102,713,955 A153T probably benign Het
Palm2 A G 4: 57,709,649 D198G possibly damaging Het
Papd5 G A 8: 88,250,743 G391D probably damaging Het
Pcdhb2 A C 18: 37,297,230 Y752S probably damaging Het
Pcnx4 A G 12: 72,556,302 D446G probably benign Het
Pnp2 G A 14: 50,964,304 R249H probably damaging Het
Rgs3 A T 4: 62,623,884 I32F probably damaging Het
Rnf139 A G 15: 58,898,878 T251A probably benign Het
Rnf41 A G 10: 128,438,235 E252G probably damaging Het
Rxfp2 T A 5: 150,051,628 F220Y probably benign Het
Sdcbp A G 4: 6,379,042 D43G possibly damaging Het
Serpina3f A G 12: 104,217,008 D43G probably damaging Het
Sftpc T C 14: 70,521,447 K154R probably null Het
Simc1 A G 13: 54,524,717 T293A probably benign Het
Skint6 A T 4: 113,184,814 probably benign Het
Slc6a15 T C 10: 103,389,347 probably benign Het
Ston2 A T 12: 91,740,602 I78N probably damaging Het
Taok3 T C 5: 117,217,242 probably null Het
Tiam1 C T 16: 89,793,001 probably benign Het
Tnfsf15 T C 4: 63,729,992 H137R possibly damaging Het
Tpte G A 8: 22,327,739 R247H possibly damaging Het
Trim2 T C 3: 84,210,169 probably benign Het
Ulk1 A T 5: 110,788,944 probably benign Het
Utp4 T G 8: 106,913,386 H442Q probably null Het
Vmn1r193 T A 13: 22,219,628 I65F probably damaging Het
Vps54 A T 11: 21,306,962 Q690L probably damaging Het
Ybx2 T C 11: 69,940,319 probably benign Het
Zbtb38 C T 9: 96,686,940 G697D possibly damaging Het
Zfp202 C T 9: 40,208,916 Q218* probably null Het
Zfp820 G A 17: 21,819,819 T176I probably benign Het
Other mutations in Cdkn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Cdkn2a APN 4 89294332 critical splice donor site probably null 0.00
R2073:Cdkn2a UTSW 4 89294493 missense possibly damaging 0.71
R4787:Cdkn2a UTSW 4 89276718 missense unknown
R5679:Cdkn2a UTSW 4 89276861 missense possibly damaging 0.88
R6863:Cdkn2a UTSW 4 89274766 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCCATGTTCTCAGGCTCATTTGG -3'
(R):5'- GCAACGTTCACGTAGCAGCTCTTC -3'

Sequencing Primer
(F):5'- CTCAGGCTCATTTGGGTTGC -3'
(R):5'- TGCTCAACTACGGTGCAG -3'
Posted On2013-04-16