Incidental Mutation 'R2124:Chrnb2'
ID229642
Institutional Source Beutler Lab
Gene Symbol Chrnb2
Ensembl Gene ENSMUSG00000027950
Gene Namecholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)
SynonymsC030030P04Rik, Acrb2, Acrb-2, [b]2-nAchR
MMRRC Submission 040127-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R2124 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89746195-89764632 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 89769341 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029562] [ENSMUST00000038356] [ENSMUST00000196726] [ENSMUST00000200558]
Predicted Effect probably benign
Transcript: ENSMUST00000029562
SMART Domains Protein: ENSMUSP00000029562
Gene: ENSMUSG00000027950

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 29 234 5.6e-75 PFAM
Pfam:Neur_chan_memb 241 477 1.7e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038356
SMART Domains Protein: ENSMUSP00000037939
Gene: ENSMUSG00000042572

DomainStartEndE-ValueType
low complexity region 2 39 N/A INTRINSIC
Blast:RWD 43 156 1e-42 BLAST
low complexity region 183 202 N/A INTRINSIC
Blast:UBCc 203 243 8e-13 BLAST
UBCc 254 415 2.8e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195940
Predicted Effect probably benign
Transcript: ENSMUST00000196726
SMART Domains Protein: ENSMUSP00000143422
Gene: ENSMUSG00000042572

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
Blast:UBCc 34 74 1e-13 BLAST
UBCc 85 246 2.8e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199427
Predicted Effect probably benign
Transcript: ENSMUST00000200558
SMART Domains Protein: ENSMUSP00000143441
Gene: ENSMUSG00000027950

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 29 234 1.5e-71 PFAM
Pfam:Neur_chan_memb 241 454 4.8e-61 PFAM
low complexity region 657 666 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neuronal acetylcholine receptors are homo- or heteropentameric complexes composed of homologous alpha and beta subunits. They belong to a superfamily of ligand-gated ion channels which allow the flow of sodium and potassium across the plasma membrane in response to ligands such as acetylcholine and nicotine. This gene encodes one of several beta subunits. Mutations in this gene are associated with autosomal dominant nocturnal frontal lobe epilepsy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have impaired responses to nicotine, but show improved passive avoidance behavior. With age, mutants show more neurodegeneration and alterations of the visual system, with decreased cortical visual acuity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Adgrg6 T C 10: 14,467,186 D339G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap3 A C 18: 37,973,350 L1480R probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Aspg G A 12: 112,121,174 V8I probably benign Het
Aven T A 2: 112,625,196 W26R probably damaging Het
Car4 T A 11: 84,964,085 probably benign Het
Cd163 C T 6: 124,318,856 R720C probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Cdh3 A T 8: 106,552,888 H712L probably damaging Het
Cdr2 T C 7: 120,982,027 E9G probably damaging Het
Col4a2 C A 8: 11,416,070 P443Q probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Ddias T C 7: 92,858,256 Q817R probably benign Het
Ddx6 C T 9: 44,624,519 Q182* probably null Het
Dhrs7 A G 12: 72,653,177 I227T probably damaging Het
Dhx8 A T 11: 101,762,245 M970L probably damaging Het
Dnah7a A T 1: 53,496,942 D2647E possibly damaging Het
Dstyk G A 1: 132,453,119 G451R possibly damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Efl1 C T 7: 82,692,913 R510C probably damaging Het
Eif4g3 A G 4: 138,184,742 E1409G probably damaging Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fcgbp T C 7: 28,092,019 Y902H probably benign Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gbp9 T A 5: 105,094,543 D110V probably damaging Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm10542 T A 18: 44,201,288 W9R probably null Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Gpaa1 A G 15: 76,333,352 Y330C probably damaging Het
Hectd4 T C 5: 121,318,639 L689P probably damaging Het
Hoxd3 C A 2: 74,744,234 P75T possibly damaging Het
Ikbkb A G 8: 22,666,020 L570P probably damaging Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Kidins220 G A 12: 25,041,303 probably null Het
Kif1b T C 4: 149,222,296 D869G probably benign Het
Loxl2 T C 14: 69,692,410 Y746H probably benign Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Msantd2 C T 9: 37,522,931 R357W probably damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Olfr866 T G 9: 20,027,501 I146L probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prkdc T C 16: 15,719,433 V1716A probably benign Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Rims1 T A 1: 22,404,508 R200* probably null Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
Sall3 C T 18: 80,971,797 G972D probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Sdk1 C A 5: 142,185,188 D1935E possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt16 T A 12: 74,238,235 S401T probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tbcd A G 11: 121,603,320 Y983C probably damaging Het
Tenm3 A G 8: 48,417,006 probably null Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Top2a T C 11: 99,004,228 I849V probably benign Het
Ttn A G 2: 76,794,448 V13516A probably damaging Het
Uxs1 A G 1: 43,774,846 L77P probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vmn2r84 A C 10: 130,391,231 M246R probably damaging Het
Vps13b T A 15: 35,646,080 N1443K probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp616 A G 11: 74,083,043 probably null Het
Zmym1 T C 4: 127,049,570 T244A probably benign Het
Other mutations in Chrnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03108:Chrnb2 APN 3 89763374 splice site probably benign
IGL03117:Chrnb2 APN 3 89763245 missense probably damaging 1.00
IGL03391:Chrnb2 APN 3 89760877 missense probably damaging 0.98
R0131:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R0131:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R0132:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R1726:Chrnb2 UTSW 3 89761202 missense probably damaging 1.00
R2095:Chrnb2 UTSW 3 89761437 missense probably benign 0.01
R3548:Chrnb2 UTSW 3 89761591 missense probably benign 0.04
R4212:Chrnb2 UTSW 3 89761544 missense probably damaging 1.00
R4902:Chrnb2 UTSW 3 89760941 missense probably damaging 1.00
R6307:Chrnb2 UTSW 3 89761524 missense probably damaging 1.00
R6751:Chrnb2 UTSW 3 89761576 missense probably damaging 1.00
R6999:Chrnb2 UTSW 3 89761315 missense possibly damaging 0.71
R7318:Chrnb2 UTSW 3 89763367 critical splice acceptor site probably null
R7826:Chrnb2 UTSW 3 89763243 missense probably damaging 1.00
R8025:Chrnb2 UTSW 3 89761342 missense probably damaging 1.00
R8094:Chrnb2 UTSW 3 89761391 missense probably damaging 1.00
R8143:Chrnb2 UTSW 3 89747323 missense unknown
R8739:Chrnb2 UTSW 3 89762439 missense probably damaging 1.00
R8809:Chrnb2 UTSW 3 89757150 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGGCTGGGAGAAACCTTTG -3'
(R):5'- GTTGTTTTAACTTCTTAGCAGCCC -3'

Sequencing Primer
(F):5'- CTTTGAAGGGGCCGAGTGATTAAAC -3'
(R):5'- TGGAAATCTGCCCGAAAAGTTC -3'
Posted On2014-09-17