Mutagenetix > Incidental Mutation

Incidental Mutation 'R2124:Kif1b'

229647

Institutional Source

Beutler Lab

Gene Symbol

Kif1b

Ensembl Gene

ENSMUSG00000063077

Gene Name

kinesin family member 1B

Synonyms

Kif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204

MMRRC Submission

040127-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2124 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

149176319-149307693 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 149222296 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 869 (D869G)

Ref Sequence

ENSEMBL: ENSMUSP00000056754 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055647] [ENSMUST00000060537]

AlphaFold

Q60575

Predicted Effect

probably benign
Transcript: ENSMUST00000055647
AA Change: D823G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077
AA Change: D823G

Domain	Start	End	E-Value	Type
KISc	3	356	5.85e-176	SMART
low complexity region	389	404	N/A	INTRINSIC
FHA	509	566	1.61e-4	SMART
coiled coil region	626	685	N/A	INTRINSIC
Pfam:KIF1B	799	846	9.7e-13	PFAM
internal_repeat_1	901	933	7.01e-7	PROSPERO
low complexity region	1165	1179	N/A	INTRINSIC
Pfam:DUF3694	1220	1368	1.1e-46	PFAM
low complexity region	1444	1461	N/A	INTRINSIC
low complexity region	1479	1507	N/A	INTRINSIC
low complexity region	1573	1591	N/A	INTRINSIC
PH	1656	1755	1.02e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000060537
AA Change: D869G

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077
AA Change: D869G

Domain	Start	End	E-Value	Type
KISc	3	362	7.61e-175	SMART
low complexity region	390	400	N/A	INTRINSIC
low complexity region	432	450	N/A	INTRINSIC
FHA	555	612	1.61e-4	SMART
coiled coil region	672	731	N/A	INTRINSIC
Pfam:KIF1B	845	892	7.1e-15	PFAM
internal_repeat_1	947	979	4.76e-7	PROSPERO
low complexity region	1211	1225	N/A	INTRINSIC
Pfam:DUF3694	1266	1413	1.1e-40	PFAM
low complexity region	1490	1507	N/A	INTRINSIC
low complexity region	1525	1553	N/A	INTRINSIC
low complexity region	1619	1637	N/A	INTRINSIC
PH	1702	1801	1.02e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133526

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	T	A	4: 62,538,872	L143M	possibly damaging	Het
Abca13	T	C	11: 9,309,013		probably benign	Het
Abcg5	T	A	17: 84,671,147	E294D	probably benign	Het
Adgrg6	T	C	10: 14,467,186	D339G	probably damaging	Het
Ahctf1	C	A	1: 179,769,452	R43L	probably damaging	Het
Ambn	T	A	5: 88,460,758		probably benign	Het
Arap3	A	C	18: 37,973,350	L1480R	probably damaging	Het
Arhgef10	A	G	8: 14,934,820	D200G	probably damaging	Het
Aspg	G	A	12: 112,121,174	V8I	probably benign	Het
Aven	T	A	2: 112,625,196	W26R	probably damaging	Het
Car4	T	A	11: 84,964,085		probably benign	Het
Cd163	C	T	6: 124,318,856	R720C	probably damaging	Het
Cdh1	A	G	8: 106,664,210	I653V	probably benign	Het
Cdh3	A	T	8: 106,552,888	H712L	probably damaging	Het
Cdr2	T	C	7: 120,982,027	E9G	probably damaging	Het
Chrnb2	T	C	3: 89,769,341		probably benign	Het
Col4a2	C	A	8: 11,416,070	P443Q	probably damaging	Het
Cyp2a12	A	G	7: 27,036,646	*493W	probably null	Het
Ddias	T	C	7: 92,858,256	Q817R	probably benign	Het
Ddx6	C	T	9: 44,624,519	Q182*	probably null	Het
Dhrs7	A	G	12: 72,653,177	I227T	probably damaging	Het
Dhx8	A	T	11: 101,762,245	M970L	probably damaging	Het
Dnah7a	A	T	1: 53,496,942	D2647E	possibly damaging	Het
Dstyk	G	A	1: 132,453,119	G451R	possibly damaging	Het
Ednrb	T	A	14: 103,821,768	D274V	probably benign	Het
Efl1	C	T	7: 82,692,913	R510C	probably damaging	Het
Eif4g3	A	G	4: 138,184,742	E1409G	probably damaging	Het
Fam78b	G	A	1: 167,078,709	V146M	probably damaging	Het
Fcgbp	T	C	7: 28,092,019	Y902H	probably benign	Het
Fgf18	A	C	11: 33,118,003	F129C	probably damaging	Het
Gbp9	T	A	5: 105,094,543	D110V	probably damaging	Het
Gm10477	A	G	X: 56,524,832	K31E	probably damaging	Het
Gm10542	T	A	18: 44,201,288	W9R	probably null	Het
Gm7173	T	C	X: 79,510,321	I267V	probably benign	Het
Gpaa1	A	G	15: 76,333,352	Y330C	probably damaging	Het
Hectd4	T	C	5: 121,318,639	L689P	probably damaging	Het
Hoxd3	C	A	2: 74,744,234	P75T	possibly damaging	Het
Ikbkb	A	G	8: 22,666,020	L570P	probably damaging	Het
Ikbkb	T	C	8: 22,667,217		probably benign	Het
Il1rap	A	T	16: 26,710,565	H379L	probably damaging	Het
Ints6l	T	A	X: 56,504,868	S718T	probably benign	Het
Jaml	T	A	9: 45,101,064	I283N	probably damaging	Het
Kidins220	G	A	12: 25,041,303		probably null	Het
Loxl2	T	C	14: 69,692,410	Y746H	probably benign	Het
Ltbr	A	G	6: 125,309,477	S249P	probably benign	Het
Mageb5	A	G	X: 91,780,095	I226T	probably damaging	Het
Msantd2	C	T	9: 37,522,931	R357W	probably damaging	Het
Neb	A	G	2: 52,264,064	F2345S	probably damaging	Het
Olfr866	T	G	9: 20,027,501	I146L	probably benign	Het
Pabpc4l	T	C	3: 46,446,841	T123A	probably benign	Het
Plekhg4	TAGTCGATGCCCGAGTC	TAGTC	8: 105,376,452		probably benign	Het
Prkdc	T	C	16: 15,719,433	V1716A	probably benign	Het
Prss37	G	A	6: 40,515,360	R186*	probably null	Het
Psg20	T	A	7: 18,681,022	Y316F	probably benign	Het
Rasgrp2	T	A	19: 6,404,395	M156K	probably benign	Het
Rims1	T	A	1: 22,404,508	R200*	probably null	Het
Rnf168	T	G	16: 32,278,218	L37R	probably damaging	Het
Sall3	C	T	18: 80,971,797	G972D	probably benign	Het
Sap18	T	A	14: 57,798,554	S66T	probably damaging	Het
Scamp5	C	A	9: 57,447,225	V49F	possibly damaging	Het
Sdk1	C	A	5: 142,185,188	D1935E	possibly damaging	Het
Setd2	A	G	9: 110,549,864	S632G	probably benign	Het
Soga1	T	C	2: 157,033,325	E835G	probably damaging	Het
Syt16	T	A	12: 74,238,235	S401T	probably damaging	Het
Tas2r106	A	T	6: 131,678,354	L178H	probably damaging	Het
Tbcd	A	G	11: 121,603,320	Y983C	probably damaging	Het
Tenm3	A	G	8: 48,417,006		probably null	Het
Tll1	T	C	8: 64,085,557	E351G	probably benign	Het
Tmem44	T	A	16: 30,547,444	K55*	probably null	Het
Top2a	T	C	11: 99,004,228	I849V	probably benign	Het
Ttn	A	G	2: 76,794,448	V13516A	probably damaging	Het
Uxs1	A	G	1: 43,774,846	L77P	probably damaging	Het
Vmn2r121	A	T	X: 124,133,742		probably null	Het
Vmn2r84	A	C	10: 130,391,231	M246R	probably damaging	Het
Vps13b	T	A	15: 35,646,080	N1443K	probably benign	Het
Wfdc6b	C	T	2: 164,617,443	R142C	probably benign	Het
Zfp616	A	G	11: 74,083,043		probably null	Het
Zmym1	T	C	4: 127,049,570	T244A	probably benign	Het

Other mutations in Kif1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01311:Kif1b	APN	4	149220602	missense	probably damaging	1.00
IGL01943:Kif1b	APN	4	149214905	critical splice donor site	probably null
IGL02240:Kif1b	APN	4	149246414	missense	probably damaging	1.00
IGL02414:Kif1b	APN	4	149199314	missense	probably damaging	0.96
IGL02490:Kif1b	APN	4	149204208	missense	probably benign
IGL02501:Kif1b	APN	4	149214976	missense	probably damaging	1.00
IGL02833:Kif1b	APN	4	149246364	missense	probably damaging	1.00
IGL02852:Kif1b	APN	4	149291328	missense	probably damaging	1.00
IGL02900:Kif1b	APN	4	149180809	missense	possibly damaging	0.81
IGL03287:Kif1b	APN	4	149214981	missense	possibly damaging	0.67
IGL03412:Kif1b	APN	4	149274939	missense	probably benign	0.00
PIT4305001:Kif1b	UTSW	4	149220792	critical splice acceptor site	probably null
R0005:Kif1b	UTSW	4	149181927	missense	probably damaging	1.00
R0044:Kif1b	UTSW	4	149263601	splice site	probably benign
R0044:Kif1b	UTSW	4	149263601	splice site	probably benign
R0129:Kif1b	UTSW	4	149261201	missense	probably benign
R0180:Kif1b	UTSW	4	149213659	missense	probably damaging	1.00
R0288:Kif1b	UTSW	4	149199338	missense	probably damaging	1.00
R0360:Kif1b	UTSW	4	149262729	missense	probably damaging	1.00
R0383:Kif1b	UTSW	4	149202512	missense	probably damaging	1.00
R0398:Kif1b	UTSW	4	149204231	missense	possibly damaging	0.89
R0403:Kif1b	UTSW	4	149181967	nonsense	probably null
R0445:Kif1b	UTSW	4	149188009	missense	probably benign	0.01
R1466:Kif1b	UTSW	4	149223252	missense	probably damaging	0.99
R1466:Kif1b	UTSW	4	149223252	missense	probably damaging	0.99
R1681:Kif1b	UTSW	4	149195501	critical splice acceptor site	probably null
R1728:Kif1b	UTSW	4	149187722	missense	probably damaging	0.99
R1840:Kif1b	UTSW	4	149188132	missense	probably damaging	1.00
R1874:Kif1b	UTSW	4	149187632	missense	probably benign
R1915:Kif1b	UTSW	4	149267216	missense	probably damaging	1.00
R2106:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2126:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2127:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2128:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2129:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2146:Kif1b	UTSW	4	149184309	missense	probably damaging	0.99
R2255:Kif1b	UTSW	4	149274997	missense	probably damaging	1.00
R2392:Kif1b	UTSW	4	149220620	missense	possibly damaging	0.93
R2883:Kif1b	UTSW	4	149237648	missense	possibly damaging	0.78
R2981:Kif1b	UTSW	4	149220541	critical splice donor site	probably null
R3038:Kif1b	UTSW	4	149213333	missense	probably benign	0.02
R3616:Kif1b	UTSW	4	149262283	splice site	probably benign
R3935:Kif1b	UTSW	4	149237160	missense	probably benign	0.00
R4347:Kif1b	UTSW	4	149247234	missense	probably damaging	1.00
R4423:Kif1b	UTSW	4	149214105	missense	probably damaging	0.99
R4637:Kif1b	UTSW	4	149199311	missense	probably damaging	0.97
R4745:Kif1b	UTSW	4	149237882	nonsense	probably null
R4807:Kif1b	UTSW	4	149247921	intron	probably benign
R5618:Kif1b	UTSW	4	149269889	missense	possibly damaging	0.94
R5644:Kif1b	UTSW	4	149238482	missense	probably damaging	0.96
R5683:Kif1b	UTSW	4	149222261	missense	probably damaging	1.00
R5696:Kif1b	UTSW	4	149273849	splice site	probably null
R6022:Kif1b	UTSW	4	149198532	missense	probably benign	0.01
R6048:Kif1b	UTSW	4	149263629	missense	probably damaging	1.00
R6137:Kif1b	UTSW	4	149238426	missense	possibly damaging	0.47
R6139:Kif1b	UTSW	4	149237532	missense	possibly damaging	0.88
R6171:Kif1b	UTSW	4	149258048	missense	probably damaging	1.00
R6250:Kif1b	UTSW	4	149213643	missense	probably benign	0.00
R6423:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6424:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6425:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6443:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6460:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6462:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6463:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6469:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6470:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6471:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6472:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6504:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6536:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6537:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6668:Kif1b	UTSW	4	149213407	missense	probably benign	0.09
R6698:Kif1b	UTSW	4	149274956	missense	probably damaging	0.99
R7065:Kif1b	UTSW	4	149202525	missense	possibly damaging	0.46
R7222:Kif1b	UTSW	4	149225157	missense	probably damaging	1.00
R7342:Kif1b	UTSW	4	149214090	missense	possibly damaging	0.94
R7720:Kif1b	UTSW	4	149182355	missense	probably benign	0.01
R7744:Kif1b	UTSW	4	149237075	missense	possibly damaging	0.83
R7797:Kif1b	UTSW	4	149237387	missense	probably benign
R7829:Kif1b	UTSW	4	149220990	splice site	probably null
R7869:Kif1b	UTSW	4	149184376	missense	probably benign	0.01
R7878:Kif1b	UTSW	4	149214997	missense	probably damaging	0.98
R7980:Kif1b	UTSW	4	149269921	missense	probably damaging	1.00
R8047:Kif1b	UTSW	4	149214922	missense	probably damaging	1.00
R8237:Kif1b	UTSW	4	149191185	missense	probably benign	0.10
R8243:Kif1b	UTSW	4	149204267	missense	probably benign
R8252:Kif1b	UTSW	4	149273805	missense	probably damaging	1.00
R8342:Kif1b	UTSW	4	149222348	missense	probably damaging	0.96
R8460:Kif1b	UTSW	4	149187620	missense	possibly damaging	0.93
R8462:Kif1b	UTSW	4	149182340	missense	probably benign	0.05
R8496:Kif1b	UTSW	4	149192611	nonsense	probably null
R8687:Kif1b	UTSW	4	149261163	nonsense	probably null
R8694:Kif1b	UTSW	4	149220567	missense	probably damaging	0.98
R8842:Kif1b	UTSW	4	149253739	missense	probably damaging	0.98
R8883:Kif1b	UTSW	4	149276885	missense	probably benign
R8971:Kif1b	UTSW	4	149247816	missense	probably damaging	1.00
R8994:Kif1b	UTSW	4	149195482	missense
R9002:Kif1b	UTSW	4	149191255	missense	probably damaging	0.96
R9227:Kif1b	UTSW	4	149237900	missense	probably damaging	1.00
R9231:Kif1b	UTSW	4	149191195	missense	possibly damaging	0.94
R9450:Kif1b	UTSW	4	149238010	missense	probably benign	0.01
R9478:Kif1b	UTSW	4	149261159	critical splice donor site	probably null
R9571:Kif1b	UTSW	4	149220641	missense	probably damaging	1.00
R9644:Kif1b	UTSW	4	149291379	missense	probably damaging	1.00
RF008:Kif1b	UTSW	4	149251738	splice site	probably null
X0009:Kif1b	UTSW	4	149247264	missense	probably damaging	1.00
X0062:Kif1b	UTSW	4	149275005	missense	probably damaging	1.00
Z1176:Kif1b	UTSW	4	149266298	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TAGGAACTGAACCTGGAACATC -3'
(R):5'- GCATTAAGTGACACGAGCAACC -3'

Sequencing Primer
(F):5'- AACATCAGGGGTGAGCTCCATC -3'
(R):5'- CTCTTAAAATACCTGGCACGCAG -3'

Posted On

2014-09-17