Incidental Mutation 'R2124:Tenm3'
ID229668
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Nameteneurin transmembrane protein 3
SynonymsTen-m3, Odz3, 2610100B16Rik
MMRRC Submission 040127-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R2124 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location48227682-48843951 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 48417006 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000110343] [ENSMUST00000110343] [ENSMUST00000110345] [ENSMUST00000110345] [ENSMUST00000110346] [ENSMUST00000110346] [ENSMUST00000190840] [ENSMUST00000190840] [ENSMUST00000211976]
Predicted Effect probably null
Transcript: ENSMUST00000033965
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110343
SMART Domains Protein: ENSMUSP00000105972
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 2.3e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110343
SMART Domains Protein: ENSMUSP00000105972
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 2.3e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110345
SMART Domains Protein: ENSMUSP00000105974
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 2.3e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110345
SMART Domains Protein: ENSMUSP00000105974
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 2.3e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110346
SMART Domains Protein: ENSMUSP00000105975
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 1.1e-14 PFAM
transmembrane domain 37 59 N/A INTRINSIC
EGF 245 273 2.32e-1 SMART
EGF_like 276 304 4.11e1 SMART
EGF 309 338 1.69e1 SMART
EGF 341 370 1.35e-2 SMART
EGF 375 405 6.11e-1 SMART
EGF 408 436 7.95e0 SMART
EGF 439 467 1.28e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110346
SMART Domains Protein: ENSMUSP00000105975
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 1.1e-14 PFAM
transmembrane domain 37 59 N/A INTRINSIC
EGF 245 273 2.32e-1 SMART
EGF_like 276 304 4.11e1 SMART
EGF 309 338 1.69e1 SMART
EGF 341 370 1.35e-2 SMART
EGF 375 405 6.11e-1 SMART
EGF 408 436 7.95e0 SMART
EGF 439 467 1.28e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190840
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000190840
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211976
Meta Mutation Damage Score 0.9461 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Adgrg6 T C 10: 14,467,186 D339G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap3 A C 18: 37,973,350 L1480R probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Aspg G A 12: 112,121,174 V8I probably benign Het
Aven T A 2: 112,625,196 W26R probably damaging Het
Car4 T A 11: 84,964,085 probably benign Het
Cd163 C T 6: 124,318,856 R720C probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Cdh3 A T 8: 106,552,888 H712L probably damaging Het
Cdr2 T C 7: 120,982,027 E9G probably damaging Het
Chrnb2 T C 3: 89,769,341 probably benign Het
Col4a2 C A 8: 11,416,070 P443Q probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Ddias T C 7: 92,858,256 Q817R probably benign Het
Ddx6 C T 9: 44,624,519 Q182* probably null Het
Dhrs7 A G 12: 72,653,177 I227T probably damaging Het
Dhx8 A T 11: 101,762,245 M970L probably damaging Het
Dnah7a A T 1: 53,496,942 D2647E possibly damaging Het
Dstyk G A 1: 132,453,119 G451R possibly damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Efl1 C T 7: 82,692,913 R510C probably damaging Het
Eif4g3 A G 4: 138,184,742 E1409G probably damaging Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fcgbp T C 7: 28,092,019 Y902H probably benign Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gbp9 T A 5: 105,094,543 D110V probably damaging Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm10542 T A 18: 44,201,288 W9R probably null Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Gpaa1 A G 15: 76,333,352 Y330C probably damaging Het
Hectd4 T C 5: 121,318,639 L689P probably damaging Het
Hoxd3 C A 2: 74,744,234 P75T possibly damaging Het
Ikbkb A G 8: 22,666,020 L570P probably damaging Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Kidins220 G A 12: 25,041,303 probably null Het
Kif1b T C 4: 149,222,296 D869G probably benign Het
Loxl2 T C 14: 69,692,410 Y746H probably benign Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Msantd2 C T 9: 37,522,931 R357W probably damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Olfr866 T G 9: 20,027,501 I146L probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prkdc T C 16: 15,719,433 V1716A probably benign Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Rims1 T A 1: 22,404,508 R200* probably null Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
Sall3 C T 18: 80,971,797 G972D probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Sdk1 C A 5: 142,185,188 D1935E possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt16 T A 12: 74,238,235 S401T probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tbcd A G 11: 121,603,320 Y983C probably damaging Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Top2a T C 11: 99,004,228 I849V probably benign Het
Ttn A G 2: 76,794,448 V13516A probably damaging Het
Uxs1 A G 1: 43,774,846 L77P probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vmn2r84 A C 10: 130,391,231 M246R probably damaging Het
Vps13b T A 15: 35,646,080 N1443K probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp616 A G 11: 74,083,043 probably null Het
Zmym1 T C 4: 127,049,570 T244A probably benign Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48417060 missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48236025 missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48279042 missense probably benign 0.39
IGL00720:Tenm3 APN 8 48276421 missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48417132 missense probably benign 0.00
IGL00976:Tenm3 APN 8 48256841 missense probably benign 0.14
IGL01469:Tenm3 APN 8 48236423 missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48276645 missense probably benign 0.09
IGL01590:Tenm3 APN 8 48228802 missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48254477 missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48236758 nonsense probably null
IGL01892:Tenm3 APN 8 48276396 missense probably benign 0.09
IGL02098:Tenm3 APN 8 48276576 missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48235476 missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48236694 missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48279198 splice site probably benign
IGL02502:Tenm3 APN 8 48288016 missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48299639 missense probably benign 0.30
IGL02543:Tenm3 APN 8 48298956 missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48276903 missense probably benign 0.02
IGL03037:Tenm3 APN 8 48298878 missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48646418 missense probably benign 0.05
IGL03268:Tenm3 APN 8 48235523 missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48235346 missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48235607 missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48293657 missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48343345 missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48342659 missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48341034 missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48236912 splice site probably benign
R0335:Tenm3 UTSW 8 48232105 missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48228975 missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48287791 missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48341160 splice site probably benign
R0573:Tenm3 UTSW 8 48674399 splice site probably benign
R0599:Tenm3 UTSW 8 48277710 missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48276156 missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48236525 missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48236594 missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48335742 missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48298965 missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48228542 missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48235582 missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48240396 missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48287893 missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48276400 missense probably benign
R1455:Tenm3 UTSW 8 48279048 missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48235971 missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48310625 missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48343316 missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48287822 missense probably benign 0.01
R1522:Tenm3 UTSW 8 48395576 missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48228981 missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48236421 missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48228993 missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48279074 missense probably benign 0.09
R1676:Tenm3 UTSW 8 48417119 missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48310634 missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48232104 missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48417179 missense probably benign 0.05
R1793:Tenm3 UTSW 8 48674544 missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48276256 missense probably benign 0.39
R1863:Tenm3 UTSW 8 48276346 missense probably benign 0.20
R1898:Tenm3 UTSW 8 48310761 missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48236313 missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48228591 missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48228668 missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48342256 critical splice donor site probably null
R2109:Tenm3 UTSW 8 48343349 missense possibly damaging 0.94
R2190:Tenm3 UTSW 8 48395544 missense probably damaging 1.00
R2204:Tenm3 UTSW 8 48674550 missense probably benign 0.17
R2233:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2234:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2235:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2237:Tenm3 UTSW 8 48342337 missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48287953 missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48240270 missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48228555 missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48277746 missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48349223 missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48349404 missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48395658 missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48293726 missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48235970 missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R4851:Tenm3 UTSW 8 48310621 critical splice donor site probably null
R4867:Tenm3 UTSW 8 48235821 missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48276861 missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48300971 missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48278961 nonsense probably null
R4995:Tenm3 UTSW 8 48229137 missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48235826 missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48342308 missense probably benign 0.14
R5228:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48229198 missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48236855 missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48287831 missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48236564 missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48367377 nonsense probably null
R5566:Tenm3 UTSW 8 48279006 missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48236764 missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48228762 missense probably damaging 1.00
R5931:Tenm3 UTSW 8 48646498 missense probably benign 0.00
R5959:Tenm3 UTSW 8 48646447 nonsense probably null
R5965:Tenm3 UTSW 8 48228508 nonsense probably null
R6062:Tenm3 UTSW 8 48343406 missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48395573 missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48298808 missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48254622 missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48293665 missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48417059 missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48367394 missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48276849 missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48236063 missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48417222 missense probably benign
R6516:Tenm3 UTSW 8 48417222 missense probably benign
R6747:Tenm3 UTSW 8 48343243 missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48646256 critical splice donor site probably null
R6788:Tenm3 UTSW 8 48674493 missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48256837 missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48276738 missense probably benign 0.39
R6913:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48674416 missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48240479 nonsense probably null
R6968:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48240444 missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48674553 missense probably benign 0.00
R7140:Tenm3 UTSW 8 48292236 missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48300969 missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48235935 missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48236177 missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48236183 missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48287812 missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48276600 missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48341049 missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48335727 missense probably benign 0.27
R7734:Tenm3 UTSW 8 48646333 missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48236465 missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48276300 missense probably benign 0.01
R7843:Tenm3 UTSW 8 48229111 nonsense probably null
R7926:Tenm3 UTSW 8 48229111 nonsense probably null
X0010:Tenm3 UTSW 8 48287829 missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48236477 missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48276780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTATCACGGAGGCGACAG -3'
(R):5'- GCGGATGCACCTACATACAC -3'

Sequencing Primer
(F):5'- GGCGACAGTCTCACCTCTTATAAGG -3'
(R):5'- TTCCGCAGAGCAACCTTC -3'
Posted On2014-09-17