Incidental Mutation 'R2124:Olfr866'
ID229673
Institutional Source Beutler Lab
Gene Symbol Olfr866
Ensembl Gene ENSMUSG00000050803
Gene Nameolfactory receptor 866
SynonymsMOR145-5, GA_x6K02T2PVTD-13768406-13767468
MMRRC Submission 040127-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R2124 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20026959-20028035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 20027501 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 146 (I146L)
Ref Sequence ENSEMBL: ENSMUSP00000054864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062248]
Predicted Effect probably benign
Transcript: ENSMUST00000062248
AA Change: I146L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054864
Gene: ENSMUSG00000050803
AA Change: I146L

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 2e-47 PFAM
Pfam:7TM_GPCR_Srsx 38 282 8.7e-7 PFAM
Pfam:7tm_1 44 293 5.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212071
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Adgrg6 T C 10: 14,467,186 D339G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap3 A C 18: 37,973,350 L1480R probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Aspg G A 12: 112,121,174 V8I probably benign Het
Aven T A 2: 112,625,196 W26R probably damaging Het
Car4 T A 11: 84,964,085 probably benign Het
Cd163 C T 6: 124,318,856 R720C probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Cdh3 A T 8: 106,552,888 H712L probably damaging Het
Cdr2 T C 7: 120,982,027 E9G probably damaging Het
Chrnb2 T C 3: 89,769,341 probably benign Het
Col4a2 C A 8: 11,416,070 P443Q probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Ddias T C 7: 92,858,256 Q817R probably benign Het
Ddx6 C T 9: 44,624,519 Q182* probably null Het
Dhrs7 A G 12: 72,653,177 I227T probably damaging Het
Dhx8 A T 11: 101,762,245 M970L probably damaging Het
Dnah7a A T 1: 53,496,942 D2647E possibly damaging Het
Dstyk G A 1: 132,453,119 G451R possibly damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Efl1 C T 7: 82,692,913 R510C probably damaging Het
Eif4g3 A G 4: 138,184,742 E1409G probably damaging Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fcgbp T C 7: 28,092,019 Y902H probably benign Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gbp9 T A 5: 105,094,543 D110V probably damaging Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm10542 T A 18: 44,201,288 W9R probably null Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Gpaa1 A G 15: 76,333,352 Y330C probably damaging Het
Hectd4 T C 5: 121,318,639 L689P probably damaging Het
Hoxd3 C A 2: 74,744,234 P75T possibly damaging Het
Ikbkb A G 8: 22,666,020 L570P probably damaging Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Kidins220 G A 12: 25,041,303 probably null Het
Kif1b T C 4: 149,222,296 D869G probably benign Het
Loxl2 T C 14: 69,692,410 Y746H probably benign Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Msantd2 C T 9: 37,522,931 R357W probably damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prkdc T C 16: 15,719,433 V1716A probably benign Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Rims1 T A 1: 22,404,508 R200* probably null Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
Sall3 C T 18: 80,971,797 G972D probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Sdk1 C A 5: 142,185,188 D1935E possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt16 T A 12: 74,238,235 S401T probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tbcd A G 11: 121,603,320 Y983C probably damaging Het
Tenm3 A G 8: 48,417,006 probably null Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Top2a T C 11: 99,004,228 I849V probably benign Het
Ttn A G 2: 76,794,448 V13516A probably damaging Het
Uxs1 A G 1: 43,774,846 L77P probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vmn2r84 A C 10: 130,391,231 M246R probably damaging Het
Vps13b T A 15: 35,646,080 N1443K probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp616 A G 11: 74,083,043 probably null Het
Zmym1 T C 4: 127,049,570 T244A probably benign Het
Other mutations in Olfr866
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Olfr866 APN 9 20027047 missense probably damaging 1.00
IGL01554:Olfr866 APN 9 20027408 missense possibly damaging 0.55
IGL01561:Olfr866 APN 9 20027522 missense probably benign 0.20
IGL01597:Olfr866 APN 9 20027686 missense probably damaging 0.98
IGL02986:Olfr866 APN 9 20027711 missense probably benign 0.43
IGL03101:Olfr866 APN 9 20027429 missense probably benign 0.03
R0863:Olfr866 UTSW 9 20027213 missense probably damaging 1.00
R1747:Olfr866 UTSW 9 20027317 missense probably benign 0.01
R2121:Olfr866 UTSW 9 20027501 missense probably benign
R2240:Olfr866 UTSW 9 20027144 missense probably damaging 1.00
R3793:Olfr866 UTSW 9 20027063 missense probably damaging 1.00
R4498:Olfr866 UTSW 9 20027733 missense possibly damaging 0.50
R5084:Olfr866 UTSW 9 20027255 missense probably damaging 0.99
R5420:Olfr866 UTSW 9 20027059 missense probably damaging 0.98
R6314:Olfr866 UTSW 9 20027662 missense probably damaging 0.98
R6357:Olfr866 UTSW 9 20027629 missense probably damaging 1.00
R6588:Olfr866 UTSW 9 20027866 missense probably damaging 0.97
R6886:Olfr866 UTSW 9 20027132 missense probably benign 0.00
R7480:Olfr866 UTSW 9 20027934 start codon destroyed probably null
Z1088:Olfr866 UTSW 9 20027279 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGAGGAGGGGATTTTCAGAATG -3'
(R):5'- ATGCACAGCAGGGTCATTTC -3'

Sequencing Primer
(F):5'- GGAAAAATGCCAAGTATGACACC -3'
(R):5'- ACAGCAGGGTCATTTCCTATGCAG -3'
Posted On2014-09-17