Incidental Mutation 'R2124:Top2a'
ID229685
Institutional Source Beutler Lab
Gene Symbol Top2a
Ensembl Gene ENSMUSG00000020914
Gene Nametopoisomerase (DNA) II alpha
SynonymsTop-2, DNA Topoisomerase II alpha
MMRRC Submission 040127-MU
Accession Numbers

Ncbi RefSeq: NM_011623.2; MGI:98790

Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R2124 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98992943-99024189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99004228 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 849 (I849V)
Ref Sequence ENSEMBL: ENSMUSP00000068896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068031]
Predicted Effect probably benign
Transcript: ENSMUST00000068031
AA Change: I849V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068896
Gene: ENSMUSG00000020914
AA Change: I849V

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TOP2c 22 60 3e-12 BLAST
HATPase_c 75 224 1.81e-2 SMART
TOP2c 79 669 N/A SMART
TOP4c 692 1166 3.58e-234 SMART
low complexity region 1192 1202 N/A INTRINSIC
low complexity region 1226 1238 N/A INTRINSIC
low complexity region 1261 1273 N/A INTRINSIC
low complexity region 1291 1306 N/A INTRINSIC
low complexity region 1407 1418 N/A INTRINSIC
Pfam:DTHCT 1425 1518 1.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151997
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, alpha, is localized to chromosome 17 and the beta gene is localized to chromosome 3. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul 2010]
Allele List at MGI

All alleles(47) : Targeted(1) Gene trapped(46)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Adgrg6 T C 10: 14,467,186 D339G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap3 A C 18: 37,973,350 L1480R probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Aspg G A 12: 112,121,174 V8I probably benign Het
Aven T A 2: 112,625,196 W26R probably damaging Het
Car4 T A 11: 84,964,085 probably benign Het
Cd163 C T 6: 124,318,856 R720C probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Cdh3 A T 8: 106,552,888 H712L probably damaging Het
Cdr2 T C 7: 120,982,027 E9G probably damaging Het
Chrnb2 T C 3: 89,769,341 probably benign Het
Col4a2 C A 8: 11,416,070 P443Q probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Ddias T C 7: 92,858,256 Q817R probably benign Het
Ddx6 C T 9: 44,624,519 Q182* probably null Het
Dhrs7 A G 12: 72,653,177 I227T probably damaging Het
Dhx8 A T 11: 101,762,245 M970L probably damaging Het
Dnah7a A T 1: 53,496,942 D2647E possibly damaging Het
Dstyk G A 1: 132,453,119 G451R possibly damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Efl1 C T 7: 82,692,913 R510C probably damaging Het
Eif4g3 A G 4: 138,184,742 E1409G probably damaging Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fcgbp T C 7: 28,092,019 Y902H probably benign Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gbp9 T A 5: 105,094,543 D110V probably damaging Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm10542 T A 18: 44,201,288 W9R probably null Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Gpaa1 A G 15: 76,333,352 Y330C probably damaging Het
Hectd4 T C 5: 121,318,639 L689P probably damaging Het
Hoxd3 C A 2: 74,744,234 P75T possibly damaging Het
Ikbkb A G 8: 22,666,020 L570P probably damaging Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Kidins220 G A 12: 25,041,303 probably null Het
Kif1b T C 4: 149,222,296 D869G probably benign Het
Loxl2 T C 14: 69,692,410 Y746H probably benign Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Msantd2 C T 9: 37,522,931 R357W probably damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Olfr866 T G 9: 20,027,501 I146L probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prkdc T C 16: 15,719,433 V1716A probably benign Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Rims1 T A 1: 22,404,508 R200* probably null Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
Sall3 C T 18: 80,971,797 G972D probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Sdk1 C A 5: 142,185,188 D1935E possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt16 T A 12: 74,238,235 S401T probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tbcd A G 11: 121,603,320 Y983C probably damaging Het
Tenm3 A G 8: 48,417,006 probably null Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Ttn A G 2: 76,794,448 V13516A probably damaging Het
Uxs1 A G 1: 43,774,846 L77P probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vmn2r84 A C 10: 130,391,231 M246R probably damaging Het
Vps13b T A 15: 35,646,080 N1443K probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp616 A G 11: 74,083,043 probably null Het
Zmym1 T C 4: 127,049,570 T244A probably benign Het
Other mutations in Top2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Top2a APN 11 99018821 nonsense probably null
IGL01285:Top2a APN 11 99006159 splice site probably benign
IGL01445:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01451:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01456:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01458:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01481:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01485:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01753:Top2a APN 11 99007274 missense probably damaging 0.97
IGL03029:Top2a APN 11 99018799 missense probably benign 0.03
PIT4581001:Top2a UTSW 11 99002964 missense probably damaging 0.97
PIT4585001:Top2a UTSW 11 99001373 missense probably benign 0.02
R0008:Top2a UTSW 11 99002903 nonsense probably null
R0047:Top2a UTSW 11 98997856 missense probably benign
R0047:Top2a UTSW 11 98997856 missense probably benign
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0116:Top2a UTSW 11 99003590 missense probably benign 0.00
R0245:Top2a UTSW 11 99010096 missense probably benign 0.37
R0276:Top2a UTSW 11 99009907 splice site probably benign
R0288:Top2a UTSW 11 99016423 splice site probably benign
R0335:Top2a UTSW 11 99022955 missense probably benign 0.08
R0422:Top2a UTSW 11 99009853 missense probably damaging 1.00
R0546:Top2a UTSW 11 98999226 missense possibly damaging 0.75
R0558:Top2a UTSW 11 98996839 missense probably benign
R0599:Top2a UTSW 11 99001417 missense probably damaging 0.99
R0727:Top2a UTSW 11 99012148 nonsense probably null
R1565:Top2a UTSW 11 99001054 missense probably damaging 0.99
R1674:Top2a UTSW 11 99009273 missense probably damaging 0.96
R1844:Top2a UTSW 11 99016069 missense probably benign 0.06
R1959:Top2a UTSW 11 98995977 splice site probably null
R2128:Top2a UTSW 11 99009807 missense probably damaging 0.97
R3707:Top2a UTSW 11 98996825 missense probably benign 0.13
R4110:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4112:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4423:Top2a UTSW 11 99001405 missense probably benign 0.00
R4425:Top2a UTSW 11 99001405 missense probably benign 0.00
R4914:Top2a UTSW 11 99002960 missense probably damaging 1.00
R4939:Top2a UTSW 11 99010092 missense probably damaging 1.00
R4944:Top2a UTSW 11 98997850 missense probably benign 0.37
R4971:Top2a UTSW 11 98993841 missense probably damaging 1.00
R5362:Top2a UTSW 11 99018912 missense probably damaging 1.00
R5477:Top2a UTSW 11 99016480 nonsense probably null
R5499:Top2a UTSW 11 99022376 missense probably benign 0.20
R5911:Top2a UTSW 11 99016465 missense possibly damaging 0.92
R7126:Top2a UTSW 11 99014992 missense probably benign 0.09
R7131:Top2a UTSW 11 99004182 missense possibly damaging 0.75
R7174:Top2a UTSW 11 99024096 start gained probably benign
R7329:Top2a UTSW 11 99004246 missense possibly damaging 0.57
R7560:Top2a UTSW 11 99000837 missense probably benign
R7563:Top2a UTSW 11 99016179 missense probably damaging 1.00
R7740:Top2a UTSW 11 98993814 missense probably benign 0.34
R7841:Top2a UTSW 11 99022350 missense probably damaging 1.00
R7894:Top2a UTSW 11 99009605 missense probably damaging 1.00
R8122:Top2a UTSW 11 98999167 missense probably benign
R8260:Top2a UTSW 11 99000769 missense probably null 0.87
R8504:Top2a UTSW 11 99014741 missense probably benign
R8550:Top2a UTSW 11 98995918 missense probably benign
R8558:Top2a UTSW 11 99021723 missense probably damaging 1.00
R8693:Top2a UTSW 11 99010042 missense probably damaging 1.00
R8851:Top2a UTSW 11 99009851 missense probably damaging 1.00
U24488:Top2a UTSW 11 99022426 missense probably damaging 1.00
X0025:Top2a UTSW 11 98995941 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TAGCGTCCAATCTCCTCAGC -3'
(R):5'- CCACCAATCTTGAACTTGAGAGG -3'

Sequencing Primer
(F):5'- CCGTGCCTGATGAGAAACAGTTC -3'
(R):5'- TTTGTCCACCAAGTGCAGG -3'
Posted On2014-09-17