Mutagenetix > Incidental Mutations

Incidental Mutation 'R2125:Mertk'

229730

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

040128-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.158) question?

Stock #

R2125 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 128762138 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 397 (D397E)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

Predicted Effect

probably benign
Transcript: ENSMUST00000014505
AA Change: D397E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: D397E

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	A	T	7: 28,158,022	Y2265F	probably benign	Het
Aadac	A	G	3: 60,039,645	T255A	possibly damaging	Het
Abcb10	A	C	8: 123,965,092	V378G	probably benign	Het
Ackr2	C	T	9: 121,908,786	R76*	probably null	Het
Acly	T	C	11: 100,523,496	T35A	probably benign	Het
Acp7	A	C	7: 28,629,549	F69V	probably damaging	Het
Acsl3	T	A	1: 78,681,961	I110N	probably damaging	Het
Adam5	C	T	8: 24,815,118	V107M	probably damaging	Het
Adck2	T	C	6: 39,575,142	V281A	probably benign	Het
Adgrv1	A	G	13: 81,419,535	V5173A	probably benign	Het
Adgrv1	A	T	13: 81,419,950	S5035T	probably benign	Het
AI314180	T	C	4: 58,833,978	H834R	probably benign	Het
Arl10	T	A	13: 54,579,124		probably null	Het
B3gnt3	A	G	8: 71,693,358	W176R	probably damaging	Het
B4galt4	T	C	16: 38,765,938	I3T	probably damaging	Het
Casr	T	C	16: 36,495,252	I819V	possibly damaging	Het
Cdh1	T	C	8: 106,656,840	V237A	probably damaging	Het
Col22a1	G	A	15: 71,848,577	R605C	unknown	Het
Crlf3	A	G	11: 80,059,255	V183A	probably benign	Het
Crtac1	C	A	19: 42,323,732	V181L	probably damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnah12	A	T	14: 26,724,458	R725*	probably null	Het
Dnhd1	A	T	7: 105,677,971	H709L	probably benign	Het
Dopey1	A	G	9: 86,521,046	Y1431C	probably damaging	Het
Eif2ak4	A	T	2: 118,422,123	H392L	probably benign	Het
Entpd3	T	C	9: 120,555,654	I99T	probably damaging	Het
Epha6	T	C	16: 59,682,688	D952G	probably damaging	Het
Exoc6	T	C	19: 37,590,941	L429P	probably damaging	Het
F13a1	A	G	13: 36,892,841	S625P	probably benign	Het
Fcho2	T	C	13: 98,775,898	N240S	possibly damaging	Het
Fcrl6	C	T	1: 172,599,248	V44M	probably benign	Het
Fmo6	A	T	1: 162,929,958	M82K	possibly damaging	Het
Gabrr2	T	G	4: 33,095,548	I479R	probably damaging	Het
Gm14409	C	A	2: 177,265,402	C101F	probably damaging	Het
Gnl2	T	A	4: 125,053,485	F633L	probably benign	Het
Greb1l	C	T	18: 10,511,422	S648F	probably damaging	Het
Gsap	T	A	5: 21,242,813	C290S	probably damaging	Het
Gusb	A	G	5: 129,999,447	V268A	probably benign	Het
H2-D1	G	A	17: 35,264,115		probably null	Het
Hebp2	T	A	10: 18,541,260	E164D	probably benign	Het
Higd1a	A	T	9: 121,850,247	I58N	probably damaging	Het
Hoxc13	G	T	15: 102,927,223	R262L	probably damaging	Het
Ifih1	A	G	2: 62,623,467	V218A	probably benign	Het
Impg2	T	A	16: 56,265,064	Y1045N	probably damaging	Het
Kcnk1	A	G	8: 125,995,656	E66G	probably damaging	Het
Klkb1	A	G	8: 45,275,504	V406A	possibly damaging	Het
Klra10	G	A	6: 130,279,278	R138W	probably damaging	Het
Lama2	A	C	10: 27,044,453	Y193*	probably null	Het
Larp7	T	C	3: 127,543,130	T428A	probably benign	Het
Lipg	T	C	18: 74,945,885	N432S	probably benign	Het
Loxl1	T	C	9: 58,293,712	D489G	probably damaging	Het
Lrguk	A	G	6: 34,092,902	K571E	probably benign	Het
Map3k13	C	T	16: 21,892,144	T59I	probably benign	Het
Mgat3	G	A	15: 80,211,886	V305I	probably benign	Het
Mkl2	T	C	16: 13,400,804	V449A	possibly damaging	Het
Mybpc1	G	A	10: 88,573,437	Q66*	probably null	Het
Myo3a	A	G	2: 22,578,174	D480G	probably benign	Het
Ndufaf3	C	T	9: 108,566,737	R31Q	probably benign	Het
Neb	T	C	2: 52,310,638	Y343C	probably damaging	Het
Nrxn3	A	G	12: 89,260,520		probably null	Het
Olfr1090	A	T	2: 86,754,452	N95K	probably benign	Het
Olfr1257	A	G	2: 89,881,638	M271V	probably benign	Het
Pcsk4	T	C	10: 80,323,879	M379V	probably benign	Het
Pdzd2	A	T	15: 12,373,590	V2153E	probably benign	Het
Pkd2l1	T	C	19: 44,154,500	D427G	possibly damaging	Het
Plcd4	A	G	1: 74,565,152	Y763C	probably damaging	Het
Plekhh1	T	C	12: 79,079,000	F1270S	probably damaging	Het
Pmfbp1	T	C	8: 109,520,273	V259A	probably damaging	Het
Ptprg	T	C	14: 12,179,283	S767P	possibly damaging	Het
Rabl3	T	G	16: 37,556,813		probably null	Het
Rffl	T	A	11: 82,818,438	H53L	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rtl1	C	T	12: 109,593,921	V495I	possibly damaging	Het
Scaf11	A	T	15: 96,419,315	D789E	possibly damaging	Het
Scn2a	T	A	2: 65,752,079	Y1590*	probably null	Het
Siglech	T	A	7: 55,771,686	F190I	probably benign	Het
Slc22a22	C	A	15: 57,254,240	A302S	probably damaging	Het
Slc46a3	T	A	5: 147,879,144	T458S	probably benign	Het
Spta1	G	T	1: 174,208,344	R1072L	possibly damaging	Het
Tbx5	A	G	5: 119,836,923	T4A	probably benign	Het
Tdrd5	T	C	1: 156,276,573	R528G	probably damaging	Het
Tfip11	T	C	5: 112,335,663	V648A	possibly damaging	Het
Thumpd3	T	C	6: 113,066,788	V388A	probably benign	Het
Tmem131l	C	T	3: 83,942,751		probably null	Het
Ttf2	C	A	3: 100,948,193	Q895H	possibly damaging	Het
Ttn	A	T	2: 76,890,092		probably null	Het
Vmn2r13	A	G	5: 109,158,192	S507P	probably benign	Het
Vtn	A	G	11: 78,500,223	T210A	probably damaging	Het
Znhit2	A	G	19: 6,062,061	T279A	probably benign	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGGATAGGAGTTTACCATTAATCTGG -3'
(R):5'- TTTAAAGGTGCCTTGCCTTGC -3'

Sequencing Primer
(F):5'- TTTGAAACCACTCAATAAC -3'
(R):5'- GCCTTGCTCAATGATAACAAGTGAC -3'

Posted On

2014-09-17