Incidental Mutation 'R2125:Gm14409'
ID229731
Institutional Source Beutler Lab
Gene Symbol Gm14409
Ensembl Gene ENSMUSG00000078869
Gene Namepredicted gene 14409
Synonyms
MMRRC Submission 040128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2125 (G1)
Quality Score93
Status Not validated
Chromosome2
Chromosomal Location177264654-177267036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 177265402 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 101 (C101F)
Ref Sequence ENSEMBL: ENSMUSP00000104591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108963]
Predicted Effect probably damaging
Transcript: ENSMUST00000108963
AA Change: C101F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104591
Gene: ENSMUSG00000078869
AA Change: C101F

DomainStartEndE-ValueType
Blast:KRAB 1 34 3e-14 BLAST
ZnF_C2H2 46 65 1.31e2 SMART
ZnF_C2H2 71 93 8.47e-4 SMART
ZnF_C2H2 99 121 5.99e-4 SMART
ZnF_C2H2 127 149 5.59e-4 SMART
ZnF_C2H2 155 177 2.53e-2 SMART
ZnF_C2H2 183 205 1.72e-4 SMART
ZnF_C2H2 211 233 2.12e-4 SMART
ZnF_C2H2 239 261 1.58e-3 SMART
ZnF_C2H2 267 289 1.03e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,158,022 Y2265F probably benign Het
Aadac A G 3: 60,039,645 T255A possibly damaging Het
Abcb10 A C 8: 123,965,092 V378G probably benign Het
Ackr2 C T 9: 121,908,786 R76* probably null Het
Acly T C 11: 100,523,496 T35A probably benign Het
Acp7 A C 7: 28,629,549 F69V probably damaging Het
Acsl3 T A 1: 78,681,961 I110N probably damaging Het
Adam5 C T 8: 24,815,118 V107M probably damaging Het
Adck2 T C 6: 39,575,142 V281A probably benign Het
Adgrv1 A G 13: 81,419,535 V5173A probably benign Het
Adgrv1 A T 13: 81,419,950 S5035T probably benign Het
AI314180 T C 4: 58,833,978 H834R probably benign Het
Arl10 T A 13: 54,579,124 probably null Het
B3gnt3 A G 8: 71,693,358 W176R probably damaging Het
B4galt4 T C 16: 38,765,938 I3T probably damaging Het
Casr T C 16: 36,495,252 I819V possibly damaging Het
Cdh1 T C 8: 106,656,840 V237A probably damaging Het
Col22a1 G A 15: 71,848,577 R605C unknown Het
Crlf3 A G 11: 80,059,255 V183A probably benign Het
Crtac1 C A 19: 42,323,732 V181L probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 A T 14: 26,724,458 R725* probably null Het
Dnhd1 A T 7: 105,677,971 H709L probably benign Het
Dopey1 A G 9: 86,521,046 Y1431C probably damaging Het
Eif2ak4 A T 2: 118,422,123 H392L probably benign Het
Entpd3 T C 9: 120,555,654 I99T probably damaging Het
Epha6 T C 16: 59,682,688 D952G probably damaging Het
Exoc6 T C 19: 37,590,941 L429P probably damaging Het
F13a1 A G 13: 36,892,841 S625P probably benign Het
Fcho2 T C 13: 98,775,898 N240S possibly damaging Het
Fcrl6 C T 1: 172,599,248 V44M probably benign Het
Fmo6 A T 1: 162,929,958 M82K possibly damaging Het
Gabrr2 T G 4: 33,095,548 I479R probably damaging Het
Gnl2 T A 4: 125,053,485 F633L probably benign Het
Greb1l C T 18: 10,511,422 S648F probably damaging Het
Gsap T A 5: 21,242,813 C290S probably damaging Het
Gusb A G 5: 129,999,447 V268A probably benign Het
H2-D1 G A 17: 35,264,115 probably null Het
Hebp2 T A 10: 18,541,260 E164D probably benign Het
Higd1a A T 9: 121,850,247 I58N probably damaging Het
Hoxc13 G T 15: 102,927,223 R262L probably damaging Het
Ifih1 A G 2: 62,623,467 V218A probably benign Het
Impg2 T A 16: 56,265,064 Y1045N probably damaging Het
Kcnk1 A G 8: 125,995,656 E66G probably damaging Het
Klkb1 A G 8: 45,275,504 V406A possibly damaging Het
Klra10 G A 6: 130,279,278 R138W probably damaging Het
Lama2 A C 10: 27,044,453 Y193* probably null Het
Larp7 T C 3: 127,543,130 T428A probably benign Het
Lipg T C 18: 74,945,885 N432S probably benign Het
Loxl1 T C 9: 58,293,712 D489G probably damaging Het
Lrguk A G 6: 34,092,902 K571E probably benign Het
Map3k13 C T 16: 21,892,144 T59I probably benign Het
Mertk T A 2: 128,762,138 D397E probably benign Het
Mgat3 G A 15: 80,211,886 V305I probably benign Het
Mkl2 T C 16: 13,400,804 V449A possibly damaging Het
Mybpc1 G A 10: 88,573,437 Q66* probably null Het
Myo3a A G 2: 22,578,174 D480G probably benign Het
Ndufaf3 C T 9: 108,566,737 R31Q probably benign Het
Neb T C 2: 52,310,638 Y343C probably damaging Het
Nrxn3 A G 12: 89,260,520 probably null Het
Olfr1090 A T 2: 86,754,452 N95K probably benign Het
Olfr1257 A G 2: 89,881,638 M271V probably benign Het
Pcsk4 T C 10: 80,323,879 M379V probably benign Het
Pdzd2 A T 15: 12,373,590 V2153E probably benign Het
Pkd2l1 T C 19: 44,154,500 D427G possibly damaging Het
Plcd4 A G 1: 74,565,152 Y763C probably damaging Het
Plekhh1 T C 12: 79,079,000 F1270S probably damaging Het
Pmfbp1 T C 8: 109,520,273 V259A probably damaging Het
Ptprg T C 14: 12,179,283 S767P possibly damaging Het
Rabl3 T G 16: 37,556,813 probably null Het
Rffl T A 11: 82,818,438 H53L probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rtl1 C T 12: 109,593,921 V495I possibly damaging Het
Scaf11 A T 15: 96,419,315 D789E possibly damaging Het
Scn2a T A 2: 65,752,079 Y1590* probably null Het
Siglech T A 7: 55,771,686 F190I probably benign Het
Slc22a22 C A 15: 57,254,240 A302S probably damaging Het
Slc46a3 T A 5: 147,879,144 T458S probably benign Het
Spta1 G T 1: 174,208,344 R1072L possibly damaging Het
Tbx5 A G 5: 119,836,923 T4A probably benign Het
Tdrd5 T C 1: 156,276,573 R528G probably damaging Het
Tfip11 T C 5: 112,335,663 V648A possibly damaging Het
Thumpd3 T C 6: 113,066,788 V388A probably benign Het
Tmem131l C T 3: 83,942,751 probably null Het
Ttf2 C A 3: 100,948,193 Q895H possibly damaging Het
Ttn A T 2: 76,890,092 probably null Het
Vmn2r13 A G 5: 109,158,192 S507P probably benign Het
Vtn A G 11: 78,500,223 T210A probably damaging Het
Znhit2 A G 19: 6,062,061 T279A probably benign Het
Other mutations in Gm14409
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1549:Gm14409 UTSW 2 177265585 missense probably damaging 1.00
R3833:Gm14409 UTSW 2 177265205 missense possibly damaging 0.64
R4438:Gm14409 UTSW 2 177265096 missense possibly damaging 0.90
R4906:Gm14409 UTSW 2 177265430 missense possibly damaging 0.90
R5083:Gm14409 UTSW 2 177265571 missense probably damaging 0.99
R5759:Gm14409 UTSW 2 177264972 nonsense probably null
R5802:Gm14409 UTSW 2 177265256 missense possibly damaging 0.95
R7026:Gm14409 UTSW 2 177265568 missense probably benign 0.02
R7761:Gm14409 UTSW 2 177265517 missense possibly damaging 0.66
R7993:Gm14409 UTSW 2 177265222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAGGCTTTACCACATTGTTTAC -3'
(R):5'- GGCATGAAAGAAGTTGTTCTGCAG -3'

Sequencing Primer
(F):5'- ACCACATTGTTTACATTCATAGGG -3'
(R):5'- TGTTCTGCAGAGCAACCC -3'
Posted On2014-09-17