Incidental Mutation 'R2125:Gusb'
ID229751
Institutional Source Beutler Lab
Gene Symbol Gusb
Ensembl Gene ENSMUSG00000025534
Gene Nameglucuronidase, beta
SynonymsGut, Gus, asd, Gur, g, Gus-s, Gus-r, adipose storage deficiency, Gus-u, Gus-t
MMRRC Submission 040128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R2125 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129989011-130003049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129999447 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 268 (V268A)
Ref Sequence ENSEMBL: ENSMUSP00000026613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026613] [ENSMUST00000111307] [ENSMUST00000111308] [ENSMUST00000201801]
Predicted Effect probably benign
Transcript: ENSMUST00000026613
AA Change: V268A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000026613
Gene: ENSMUSG00000025534
AA Change: V268A

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 223 4e-46 PFAM
Pfam:Glyco_hydro_2 225 323 6.4e-12 PFAM
Pfam:Glyco_hydro_2_C 325 627 9e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111307
SMART Domains Protein: ENSMUSP00000106939
Gene: ENSMUSG00000025534

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 143 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111308
SMART Domains Protein: ENSMUSP00000106940
Gene: ENSMUSG00000025534

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 223 7.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122994
Predicted Effect probably benign
Transcript: ENSMUST00000201801
SMART Domains Protein: ENSMUSP00000144478
Gene: ENSMUSG00000025534

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 138 5.5e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hydrolase that degrades glycosaminoglycans, including heparan sulfate, dermatan sulfate, and chondroitin-4,6-sulfate. The enzyme forms a homotetramer that is localized to the lysosome. Mutations in this gene result in mucopolysaccharidosis type VII. Alternative splicing results in multiple transcript variants. There are many pseudogenes of this locus in the human genome.[provided by RefSeq, May 2014]
PHENOTYPE: Knock-in mutations of this gene lead to lysosomal storage disease and may cause premature death, facial, tail and limb anomalies, growth retardation, male sterility, reduced lactation, osteosclerosis and behavioral defects. Additional phenotypes include partial neonatal death and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,158,022 Y2265F probably benign Het
Aadac A G 3: 60,039,645 T255A possibly damaging Het
Abcb10 A C 8: 123,965,092 V378G probably benign Het
Ackr2 C T 9: 121,908,786 R76* probably null Het
Acly T C 11: 100,523,496 T35A probably benign Het
Acp7 A C 7: 28,629,549 F69V probably damaging Het
Acsl3 T A 1: 78,681,961 I110N probably damaging Het
Adam5 C T 8: 24,815,118 V107M probably damaging Het
Adck2 T C 6: 39,575,142 V281A probably benign Het
Adgrv1 A G 13: 81,419,535 V5173A probably benign Het
Adgrv1 A T 13: 81,419,950 S5035T probably benign Het
AI314180 T C 4: 58,833,978 H834R probably benign Het
Arl10 T A 13: 54,579,124 probably null Het
B3gnt3 A G 8: 71,693,358 W176R probably damaging Het
B4galt4 T C 16: 38,765,938 I3T probably damaging Het
Casr T C 16: 36,495,252 I819V possibly damaging Het
Cdh1 T C 8: 106,656,840 V237A probably damaging Het
Col22a1 G A 15: 71,848,577 R605C unknown Het
Crlf3 A G 11: 80,059,255 V183A probably benign Het
Crtac1 C A 19: 42,323,732 V181L probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 A T 14: 26,724,458 R725* probably null Het
Dnhd1 A T 7: 105,677,971 H709L probably benign Het
Dopey1 A G 9: 86,521,046 Y1431C probably damaging Het
Eif2ak4 A T 2: 118,422,123 H392L probably benign Het
Entpd3 T C 9: 120,555,654 I99T probably damaging Het
Epha6 T C 16: 59,682,688 D952G probably damaging Het
Exoc6 T C 19: 37,590,941 L429P probably damaging Het
F13a1 A G 13: 36,892,841 S625P probably benign Het
Fcho2 T C 13: 98,775,898 N240S possibly damaging Het
Fcrl6 C T 1: 172,599,248 V44M probably benign Het
Fmo6 A T 1: 162,929,958 M82K possibly damaging Het
Gabrr2 T G 4: 33,095,548 I479R probably damaging Het
Gm14409 C A 2: 177,265,402 C101F probably damaging Het
Gnl2 T A 4: 125,053,485 F633L probably benign Het
Greb1l C T 18: 10,511,422 S648F probably damaging Het
Gsap T A 5: 21,242,813 C290S probably damaging Het
H2-D1 G A 17: 35,264,115 probably null Het
Hebp2 T A 10: 18,541,260 E164D probably benign Het
Higd1a A T 9: 121,850,247 I58N probably damaging Het
Hoxc13 G T 15: 102,927,223 R262L probably damaging Het
Ifih1 A G 2: 62,623,467 V218A probably benign Het
Impg2 T A 16: 56,265,064 Y1045N probably damaging Het
Kcnk1 A G 8: 125,995,656 E66G probably damaging Het
Klkb1 A G 8: 45,275,504 V406A possibly damaging Het
Klra10 G A 6: 130,279,278 R138W probably damaging Het
Lama2 A C 10: 27,044,453 Y193* probably null Het
Larp7 T C 3: 127,543,130 T428A probably benign Het
Lipg T C 18: 74,945,885 N432S probably benign Het
Loxl1 T C 9: 58,293,712 D489G probably damaging Het
Lrguk A G 6: 34,092,902 K571E probably benign Het
Map3k13 C T 16: 21,892,144 T59I probably benign Het
Mertk T A 2: 128,762,138 D397E probably benign Het
Mgat3 G A 15: 80,211,886 V305I probably benign Het
Mkl2 T C 16: 13,400,804 V449A possibly damaging Het
Mybpc1 G A 10: 88,573,437 Q66* probably null Het
Myo3a A G 2: 22,578,174 D480G probably benign Het
Ndufaf3 C T 9: 108,566,737 R31Q probably benign Het
Neb T C 2: 52,310,638 Y343C probably damaging Het
Nrxn3 A G 12: 89,260,520 probably null Het
Olfr1090 A T 2: 86,754,452 N95K probably benign Het
Olfr1257 A G 2: 89,881,638 M271V probably benign Het
Pcsk4 T C 10: 80,323,879 M379V probably benign Het
Pdzd2 A T 15: 12,373,590 V2153E probably benign Het
Pkd2l1 T C 19: 44,154,500 D427G possibly damaging Het
Plcd4 A G 1: 74,565,152 Y763C probably damaging Het
Plekhh1 T C 12: 79,079,000 F1270S probably damaging Het
Pmfbp1 T C 8: 109,520,273 V259A probably damaging Het
Ptprg T C 14: 12,179,283 S767P possibly damaging Het
Rabl3 T G 16: 37,556,813 probably null Het
Rffl T A 11: 82,818,438 H53L probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rtl1 C T 12: 109,593,921 V495I possibly damaging Het
Scaf11 A T 15: 96,419,315 D789E possibly damaging Het
Scn2a T A 2: 65,752,079 Y1590* probably null Het
Siglech T A 7: 55,771,686 F190I probably benign Het
Slc22a22 C A 15: 57,254,240 A302S probably damaging Het
Slc46a3 T A 5: 147,879,144 T458S probably benign Het
Spta1 G T 1: 174,208,344 R1072L possibly damaging Het
Tbx5 A G 5: 119,836,923 T4A probably benign Het
Tdrd5 T C 1: 156,276,573 R528G probably damaging Het
Tfip11 T C 5: 112,335,663 V648A possibly damaging Het
Thumpd3 T C 6: 113,066,788 V388A probably benign Het
Tmem131l C T 3: 83,942,751 probably null Het
Ttf2 C A 3: 100,948,193 Q895H possibly damaging Het
Ttn A T 2: 76,890,092 probably null Het
Vmn2r13 A G 5: 109,158,192 S507P probably benign Het
Vtn A G 11: 78,500,223 T210A probably damaging Het
Znhit2 A G 19: 6,062,061 T279A probably benign Het
Other mutations in Gusb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gusb APN 5 129999381 missense probably damaging 1.00
IGL01561:Gusb APN 5 129998086 missense probably damaging 1.00
IGL02642:Gusb APN 5 130000535 intron probably null
IGL03307:Gusb APN 5 130000031 makesense probably null
R0389:Gusb UTSW 5 129998086 missense probably damaging 1.00
R1496:Gusb UTSW 5 129998544 missense probably benign 0.00
R1512:Gusb UTSW 5 130000890 missense probably damaging 1.00
R2888:Gusb UTSW 5 130000502 missense probably damaging 1.00
R2890:Gusb UTSW 5 130000502 missense probably damaging 1.00
R3017:Gusb UTSW 5 130000484 missense probably damaging 1.00
R4453:Gusb UTSW 5 129998483 missense possibly damaging 0.84
R4906:Gusb UTSW 5 129998118 missense probably damaging 0.98
R4937:Gusb UTSW 5 129995485 missense probably damaging 0.99
R5260:Gusb UTSW 5 129999988 nonsense probably null
R5281:Gusb UTSW 5 129998526 missense probably benign 0.00
R6194:Gusb UTSW 5 129990065 missense possibly damaging 0.46
R6248:Gusb UTSW 5 130000525 missense probably benign 0.01
R7121:Gusb UTSW 5 130000043 missense probably benign 0.44
R7209:Gusb UTSW 5 129998546 missense probably benign
R7768:Gusb UTSW 5 130000405 missense probably benign 0.01
Z1177:Gusb UTSW 5 130002736 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TTAGCCACCTGTCCTGGTTG -3'
(R):5'- AAAACATTGGGTCACTTCCTTC -3'

Sequencing Primer
(F):5'- TGGTTGCCTGCTGTCACCAG -3'
(R):5'- GTAACTCCTAATCTCTGCACAGTAAG -3'
Posted On2014-09-17