Incidental Mutation 'R2125:Mybpc1'
ID 229781
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Name myosin binding protein C, slow-type
Synonyms Slow-type C-protein, 8030451F13Rik
MMRRC Submission 040128-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.862) question?
Stock # R2125 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 88354141-88441014 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 88409299 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 66 (Q66*)
Ref Sequence ENSEMBL: ENSMUSP00000112615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
AlphaFold A0A571BEN1
Predicted Effect probably null
Transcript: ENSMUST00000119185
AA Change: Q52*
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: Q52*

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121629
AA Change: Q66*
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: Q66*

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A G 3: 59,947,066 (GRCm39) T255A possibly damaging Het
Abcb10 A C 8: 124,691,831 (GRCm39) V378G probably benign Het
Ackr2 C T 9: 121,737,852 (GRCm39) R76* probably null Het
Acly T C 11: 100,414,322 (GRCm39) T35A probably benign Het
Acp7 A C 7: 28,328,974 (GRCm39) F69V probably damaging Het
Acsl3 T A 1: 78,659,678 (GRCm39) I110N probably damaging Het
Adam5 C T 8: 25,305,134 (GRCm39) V107M probably damaging Het
Adck2 T C 6: 39,552,076 (GRCm39) V281A probably benign Het
Adgrv1 A G 13: 81,567,654 (GRCm39) V5173A probably benign Het
Adgrv1 A T 13: 81,568,069 (GRCm39) S5035T probably benign Het
Arl10 T A 13: 54,726,937 (GRCm39) probably null Het
B3gnt3 A G 8: 72,146,002 (GRCm39) W176R probably damaging Het
B4galt4 T C 16: 38,586,300 (GRCm39) I3T probably damaging Het
Casr T C 16: 36,315,614 (GRCm39) I819V possibly damaging Het
Cdh1 T C 8: 107,383,472 (GRCm39) V237A probably damaging Het
Col22a1 G A 15: 71,720,426 (GRCm39) R605C unknown Het
Crlf3 A G 11: 79,950,081 (GRCm39) V183A probably benign Het
Crtac1 C A 19: 42,312,171 (GRCm39) V181L probably damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dnah12 A T 14: 26,445,613 (GRCm39) R725* probably null Het
Dnhd1 A T 7: 105,327,178 (GRCm39) H709L probably benign Het
Dop1a A G 9: 86,403,099 (GRCm39) Y1431C probably damaging Het
Ecpas T C 4: 58,833,978 (GRCm39) H834R probably benign Het
Eif2ak4 A T 2: 118,252,604 (GRCm39) H392L probably benign Het
Entpd3 T C 9: 120,384,720 (GRCm39) I99T probably damaging Het
Epha6 T C 16: 59,503,051 (GRCm39) D952G probably damaging Het
Exoc6 T C 19: 37,579,389 (GRCm39) L429P probably damaging Het
F13a1 A G 13: 37,076,815 (GRCm39) S625P probably benign Het
Fcgbpl1 A T 7: 27,857,447 (GRCm39) Y2265F probably benign Het
Fcho2 T C 13: 98,912,406 (GRCm39) N240S possibly damaging Het
Fcrl6 C T 1: 172,426,815 (GRCm39) V44M probably benign Het
Fmo6 A T 1: 162,757,527 (GRCm39) M82K possibly damaging Het
Gabrr2 T G 4: 33,095,548 (GRCm39) I479R probably damaging Het
Gnl2 T A 4: 124,947,278 (GRCm39) F633L probably benign Het
Greb1l C T 18: 10,511,422 (GRCm39) S648F probably damaging Het
Gsap T A 5: 21,447,811 (GRCm39) C290S probably damaging Het
Gusb A G 5: 130,028,288 (GRCm39) V268A probably benign Het
H2-D1 G A 17: 35,483,091 (GRCm39) probably null Het
Hebp2 T A 10: 18,417,008 (GRCm39) E164D probably benign Het
Higd1a A T 9: 121,679,313 (GRCm39) I58N probably damaging Het
Hoxc13 G T 15: 102,835,658 (GRCm39) R262L probably damaging Het
Ifih1 A G 2: 62,453,811 (GRCm39) V218A probably benign Het
Impg2 T A 16: 56,085,427 (GRCm39) Y1045N probably damaging Het
Kcnk1 A G 8: 126,722,395 (GRCm39) E66G probably damaging Het
Klkb1 A G 8: 45,728,541 (GRCm39) V406A possibly damaging Het
Klra10 G A 6: 130,256,241 (GRCm39) R138W probably damaging Het
Lama2 A C 10: 26,920,449 (GRCm39) Y193* probably null Het
Larp7 T C 3: 127,336,779 (GRCm39) T428A probably benign Het
Lipg T C 18: 75,078,956 (GRCm39) N432S probably benign Het
Loxl1 T C 9: 58,200,995 (GRCm39) D489G probably damaging Het
Lrguk A G 6: 34,069,837 (GRCm39) K571E probably benign Het
Map3k13 C T 16: 21,710,894 (GRCm39) T59I probably benign Het
Mertk T A 2: 128,604,058 (GRCm39) D397E probably benign Het
Mgat3 G A 15: 80,096,087 (GRCm39) V305I probably benign Het
Mrtfb T C 16: 13,218,668 (GRCm39) V449A possibly damaging Het
Myo3a A G 2: 22,468,186 (GRCm39) D480G probably benign Het
Ndufaf3 C T 9: 108,443,936 (GRCm39) R31Q probably benign Het
Neb T C 2: 52,200,650 (GRCm39) Y343C probably damaging Het
Nrxn3 A G 12: 89,227,290 (GRCm39) probably null Het
Or4c10b A G 2: 89,711,982 (GRCm39) M271V probably benign Het
Or8k40 A T 2: 86,584,796 (GRCm39) N95K probably benign Het
Pcsk4 T C 10: 80,159,713 (GRCm39) M379V probably benign Het
Pdzd2 A T 15: 12,373,676 (GRCm39) V2153E probably benign Het
Pkd2l1 T C 19: 44,142,939 (GRCm39) D427G possibly damaging Het
Plcd4 A G 1: 74,604,311 (GRCm39) Y763C probably damaging Het
Plekhh1 T C 12: 79,125,774 (GRCm39) F1270S probably damaging Het
Pmfbp1 T C 8: 110,246,905 (GRCm39) V259A probably damaging Het
Ptprg T C 14: 12,179,283 (GRCm38) S767P possibly damaging Het
Rabl3 T G 16: 37,377,175 (GRCm39) probably null Het
Rffl T A 11: 82,709,264 (GRCm39) H53L probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rtl1 C T 12: 109,560,355 (GRCm39) V495I possibly damaging Het
Scaf11 A T 15: 96,317,196 (GRCm39) D789E possibly damaging Het
Scn2a T A 2: 65,582,423 (GRCm39) Y1590* probably null Het
Siglech T A 7: 55,421,434 (GRCm39) F190I probably benign Het
Slc22a22 C A 15: 57,117,636 (GRCm39) A302S probably damaging Het
Slc46a3 T A 5: 147,815,954 (GRCm39) T458S probably benign Het
Spta1 G T 1: 174,035,910 (GRCm39) R1072L possibly damaging Het
Tbx5 A G 5: 119,974,988 (GRCm39) T4A probably benign Het
Tdrd5 T C 1: 156,104,143 (GRCm39) R528G probably damaging Het
Tfip11 T C 5: 112,483,529 (GRCm39) V648A possibly damaging Het
Thumpd3 T C 6: 113,043,749 (GRCm39) V388A probably benign Het
Tmem131l C T 3: 83,850,058 (GRCm39) probably null Het
Ttf2 C A 3: 100,855,509 (GRCm39) Q895H possibly damaging Het
Ttn A T 2: 76,720,436 (GRCm39) probably null Het
Vmn2r13 A G 5: 109,306,058 (GRCm39) S507P probably benign Het
Vtn A G 11: 78,391,049 (GRCm39) T210A probably damaging Het
Zfp1010 C A 2: 176,957,195 (GRCm39) C101F probably damaging Het
Znhit2 A G 19: 6,112,091 (GRCm39) T279A probably benign Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88,385,124 (GRCm39) missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88,372,246 (GRCm39) missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88,360,970 (GRCm39) splice site probably null
IGL00964:Mybpc1 APN 10 88,391,604 (GRCm39) critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88,406,507 (GRCm39) missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88,367,632 (GRCm39) missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88,372,290 (GRCm39) missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88,362,235 (GRCm39) missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88,376,822 (GRCm39) missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88,407,378 (GRCm39) splice site probably benign
R1321:Mybpc1 UTSW 10 88,406,463 (GRCm39) missense probably damaging 1.00
R1321:Mybpc1 UTSW 10 88,365,403 (GRCm39) missense possibly damaging 0.85
R1562:Mybpc1 UTSW 10 88,389,193 (GRCm39) missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88,389,157 (GRCm39) missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88,384,688 (GRCm39) missense probably damaging 1.00
R1972:Mybpc1 UTSW 10 88,387,404 (GRCm39) missense probably benign 0.00
R2006:Mybpc1 UTSW 10 88,381,921 (GRCm39) missense probably damaging 0.99
R2129:Mybpc1 UTSW 10 88,387,314 (GRCm39) missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88,376,804 (GRCm39) splice site probably benign
R2200:Mybpc1 UTSW 10 88,391,557 (GRCm39) missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88,391,540 (GRCm39) missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88,387,269 (GRCm39) missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88,367,641 (GRCm39) missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88,406,521 (GRCm39) splice site probably null
R4032:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88,409,387 (GRCm39) nonsense probably null
R4821:Mybpc1 UTSW 10 88,384,727 (GRCm39) missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R4876:Mybpc1 UTSW 10 88,358,853 (GRCm39) missense probably benign
R4878:Mybpc1 UTSW 10 88,387,292 (GRCm39) missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88,391,586 (GRCm39) nonsense probably null
R4913:Mybpc1 UTSW 10 88,389,116 (GRCm39) critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88,391,525 (GRCm39) missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88,379,636 (GRCm39) missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88,381,926 (GRCm39) missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88,372,213 (GRCm39) missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88,358,876 (GRCm39) missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88,381,891 (GRCm39) missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88,406,428 (GRCm39) missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88,378,318 (GRCm39) missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88,404,481 (GRCm39) missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88,396,217 (GRCm39) missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88,389,139 (GRCm39) missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88,358,861 (GRCm39) missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88,372,243 (GRCm39) missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88,378,192 (GRCm39) nonsense probably null
R6972:Mybpc1 UTSW 10 88,396,223 (GRCm39) missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88,396,223 (GRCm39) missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88,358,886 (GRCm39) missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88,389,274 (GRCm39) missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88,379,581 (GRCm39) missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88,385,209 (GRCm39) missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88,362,155 (GRCm39) missense probably damaging 1.00
R7577:Mybpc1 UTSW 10 88,385,187 (GRCm39) missense probably damaging 1.00
R7660:Mybpc1 UTSW 10 88,384,716 (GRCm39) missense possibly damaging 0.51
R7768:Mybpc1 UTSW 10 88,378,234 (GRCm39) missense probably damaging 1.00
R7818:Mybpc1 UTSW 10 88,394,529 (GRCm39) missense probably damaging 1.00
R8171:Mybpc1 UTSW 10 88,358,865 (GRCm39) missense probably damaging 1.00
R8195:Mybpc1 UTSW 10 88,394,553 (GRCm39) missense possibly damaging 0.47
R8241:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R8360:Mybpc1 UTSW 10 88,409,359 (GRCm39) nonsense probably null
R8494:Mybpc1 UTSW 10 88,362,291 (GRCm39) missense probably benign 0.01
R8849:Mybpc1 UTSW 10 88,407,447 (GRCm39) missense probably benign 0.01
R8936:Mybpc1 UTSW 10 88,394,437 (GRCm39) missense probably benign 0.44
R9031:Mybpc1 UTSW 10 88,358,906 (GRCm39) missense probably damaging 0.99
R9061:Mybpc1 UTSW 10 88,391,501 (GRCm39) missense probably damaging 1.00
R9081:Mybpc1 UTSW 10 88,389,168 (GRCm39) missense probably damaging 1.00
R9172:Mybpc1 UTSW 10 88,379,615 (GRCm39) missense possibly damaging 0.93
R9323:Mybpc1 UTSW 10 88,360,829 (GRCm39) critical splice donor site probably null
R9460:Mybpc1 UTSW 10 88,372,197 (GRCm39) missense probably damaging 0.99
R9488:Mybpc1 UTSW 10 88,379,624 (GRCm39) missense possibly damaging 0.47
R9757:Mybpc1 UTSW 10 88,372,257 (GRCm39) missense probably damaging 1.00
R9796:Mybpc1 UTSW 10 88,406,497 (GRCm39) missense possibly damaging 0.56
Z1176:Mybpc1 UTSW 10 88,396,189 (GRCm39) missense probably benign
Z1177:Mybpc1 UTSW 10 88,409,299 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGATGCTAGATCTCCTGG -3'
(R):5'- AATGAGAATCTGTCCCTCTCCAC -3'

Sequencing Primer
(F):5'- CTAGATCTCCTGGGGGTGC -3'
(R):5'- GGACAAGGGAATGCTGTCATTTTATC -3'
Posted On 2014-09-17