Incidental Mutation 'R2125:Ptprg'
ID229797
Institutional Source Beutler Lab
Gene Symbol Ptprg
Ensembl Gene ENSMUSG00000021745
Gene Nameprotein tyrosine phosphatase, receptor type, G
Synonyms5430405N12Rik, RPTPgamma
MMRRC Submission 040128-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2125 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location11553532-12242041 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12179283 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 767 (S767P)
Ref Sequence ENSEMBL: ENSMUSP00000022264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000142917] [ENSMUST00000226099]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022264
AA Change: S767P

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745
AA Change: S767P

DomainStartEndE-ValueType
Carb_anhydrase 60 321 6.38e-109 SMART
FN3 347 433 5.4e-7 SMART
low complexity region 474 484 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
transmembrane domain 734 756 N/A INTRINSIC
PTPc 844 1118 1.76e-136 SMART
PTPc 1146 1409 1.32e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142917
SMART Domains Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

DomainStartEndE-ValueType
Carb_anhydrase 60 260 1.6e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223890
Predicted Effect probably benign
Transcript: ENSMUST00000226099
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,158,022 Y2265F probably benign Het
Aadac A G 3: 60,039,645 T255A possibly damaging Het
Abcb10 A C 8: 123,965,092 V378G probably benign Het
Ackr2 C T 9: 121,908,786 R76* probably null Het
Acly T C 11: 100,523,496 T35A probably benign Het
Acp7 A C 7: 28,629,549 F69V probably damaging Het
Acsl3 T A 1: 78,681,961 I110N probably damaging Het
Adam5 C T 8: 24,815,118 V107M probably damaging Het
Adck2 T C 6: 39,575,142 V281A probably benign Het
Adgrv1 A G 13: 81,419,535 V5173A probably benign Het
Adgrv1 A T 13: 81,419,950 S5035T probably benign Het
AI314180 T C 4: 58,833,978 H834R probably benign Het
Arl10 T A 13: 54,579,124 probably null Het
B3gnt3 A G 8: 71,693,358 W176R probably damaging Het
B4galt4 T C 16: 38,765,938 I3T probably damaging Het
Casr T C 16: 36,495,252 I819V possibly damaging Het
Cdh1 T C 8: 106,656,840 V237A probably damaging Het
Col22a1 G A 15: 71,848,577 R605C unknown Het
Crlf3 A G 11: 80,059,255 V183A probably benign Het
Crtac1 C A 19: 42,323,732 V181L probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 A T 14: 26,724,458 R725* probably null Het
Dnhd1 A T 7: 105,677,971 H709L probably benign Het
Dopey1 A G 9: 86,521,046 Y1431C probably damaging Het
Eif2ak4 A T 2: 118,422,123 H392L probably benign Het
Entpd3 T C 9: 120,555,654 I99T probably damaging Het
Epha6 T C 16: 59,682,688 D952G probably damaging Het
Exoc6 T C 19: 37,590,941 L429P probably damaging Het
F13a1 A G 13: 36,892,841 S625P probably benign Het
Fcho2 T C 13: 98,775,898 N240S possibly damaging Het
Fcrl6 C T 1: 172,599,248 V44M probably benign Het
Fmo6 A T 1: 162,929,958 M82K possibly damaging Het
Gabrr2 T G 4: 33,095,548 I479R probably damaging Het
Gm14409 C A 2: 177,265,402 C101F probably damaging Het
Gnl2 T A 4: 125,053,485 F633L probably benign Het
Greb1l C T 18: 10,511,422 S648F probably damaging Het
Gsap T A 5: 21,242,813 C290S probably damaging Het
Gusb A G 5: 129,999,447 V268A probably benign Het
H2-D1 G A 17: 35,264,115 probably null Het
Hebp2 T A 10: 18,541,260 E164D probably benign Het
Higd1a A T 9: 121,850,247 I58N probably damaging Het
Hoxc13 G T 15: 102,927,223 R262L probably damaging Het
Ifih1 A G 2: 62,623,467 V218A probably benign Het
Impg2 T A 16: 56,265,064 Y1045N probably damaging Het
Kcnk1 A G 8: 125,995,656 E66G probably damaging Het
Klkb1 A G 8: 45,275,504 V406A possibly damaging Het
Klra10 G A 6: 130,279,278 R138W probably damaging Het
Lama2 A C 10: 27,044,453 Y193* probably null Het
Larp7 T C 3: 127,543,130 T428A probably benign Het
Lipg T C 18: 74,945,885 N432S probably benign Het
Loxl1 T C 9: 58,293,712 D489G probably damaging Het
Lrguk A G 6: 34,092,902 K571E probably benign Het
Map3k13 C T 16: 21,892,144 T59I probably benign Het
Mertk T A 2: 128,762,138 D397E probably benign Het
Mgat3 G A 15: 80,211,886 V305I probably benign Het
Mkl2 T C 16: 13,400,804 V449A possibly damaging Het
Mybpc1 G A 10: 88,573,437 Q66* probably null Het
Myo3a A G 2: 22,578,174 D480G probably benign Het
Ndufaf3 C T 9: 108,566,737 R31Q probably benign Het
Neb T C 2: 52,310,638 Y343C probably damaging Het
Nrxn3 A G 12: 89,260,520 probably null Het
Olfr1090 A T 2: 86,754,452 N95K probably benign Het
Olfr1257 A G 2: 89,881,638 M271V probably benign Het
Pcsk4 T C 10: 80,323,879 M379V probably benign Het
Pdzd2 A T 15: 12,373,590 V2153E probably benign Het
Pkd2l1 T C 19: 44,154,500 D427G possibly damaging Het
Plcd4 A G 1: 74,565,152 Y763C probably damaging Het
Plekhh1 T C 12: 79,079,000 F1270S probably damaging Het
Pmfbp1 T C 8: 109,520,273 V259A probably damaging Het
Rabl3 T G 16: 37,556,813 probably null Het
Rffl T A 11: 82,818,438 H53L probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rtl1 C T 12: 109,593,921 V495I possibly damaging Het
Scaf11 A T 15: 96,419,315 D789E possibly damaging Het
Scn2a T A 2: 65,752,079 Y1590* probably null Het
Siglech T A 7: 55,771,686 F190I probably benign Het
Slc22a22 C A 15: 57,254,240 A302S probably damaging Het
Slc46a3 T A 5: 147,879,144 T458S probably benign Het
Spta1 G T 1: 174,208,344 R1072L possibly damaging Het
Tbx5 A G 5: 119,836,923 T4A probably benign Het
Tdrd5 T C 1: 156,276,573 R528G probably damaging Het
Tfip11 T C 5: 112,335,663 V648A possibly damaging Het
Thumpd3 T C 6: 113,066,788 V388A probably benign Het
Tmem131l C T 3: 83,942,751 probably null Het
Ttf2 C A 3: 100,948,193 Q895H possibly damaging Het
Ttn A T 2: 76,890,092 probably null Het
Vmn2r13 A G 5: 109,158,192 S507P probably benign Het
Vtn A G 11: 78,500,223 T210A probably damaging Het
Znhit2 A G 19: 6,062,061 T279A probably benign Het
Other mutations in Ptprg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ptprg APN 14 12215992 missense probably damaging 1.00
IGL00484:Ptprg APN 14 12215220 missense probably damaging 0.99
IGL00847:Ptprg APN 14 12215265 missense probably damaging 1.00
IGL01089:Ptprg APN 14 12215286 missense probably damaging 0.97
IGL01382:Ptprg APN 14 12237797 missense probably benign 0.16
IGL01470:Ptprg APN 14 12213702 nonsense probably null
IGL01762:Ptprg APN 14 12037386 missense probably benign 0.00
IGL01886:Ptprg APN 14 12179280 missense probably benign 0.22
IGL01963:Ptprg APN 14 12220661 missense probably damaging 1.00
IGL02015:Ptprg APN 14 12237782 missense possibly damaging 0.46
IGL02086:Ptprg APN 14 12110080 nonsense probably null
IGL02197:Ptprg APN 14 12220613 missense probably damaging 0.98
IGL02341:Ptprg APN 14 12154360 missense probably benign 0.00
IGL02732:Ptprg APN 14 12225617 critical splice donor site probably null
IGL03011:Ptprg APN 14 12219029 missense probably damaging 1.00
IGL03261:Ptprg APN 14 12225552 missense probably damaging 0.99
R0038:Ptprg UTSW 14 12213710 missense probably damaging 1.00
R0383:Ptprg UTSW 14 12219024 missense possibly damaging 0.93
R0433:Ptprg UTSW 14 12220620 missense probably damaging 1.00
R0488:Ptprg UTSW 14 12220653 missense probably damaging 1.00
R0503:Ptprg UTSW 14 12237138 missense possibly damaging 0.89
R0520:Ptprg UTSW 14 12199783 missense possibly damaging 0.92
R0570:Ptprg UTSW 14 12215896 missense probably damaging 1.00
R0606:Ptprg UTSW 14 12154131 missense probably benign
R1086:Ptprg UTSW 14 11952706 splice site probably benign
R1468:Ptprg UTSW 14 12190767 missense probably benign 0.02
R1468:Ptprg UTSW 14 12190767 missense probably benign 0.02
R1519:Ptprg UTSW 14 12220596 missense probably damaging 1.00
R1662:Ptprg UTSW 14 12207357 missense probably damaging 1.00
R1714:Ptprg UTSW 14 12213697 missense probably damaging 1.00
R1716:Ptprg UTSW 14 12154360 missense probably benign 0.00
R1797:Ptprg UTSW 14 12199743 missense probably damaging 1.00
R1803:Ptprg UTSW 14 12091410 splice site probably null
R2104:Ptprg UTSW 14 11952897 critical splice donor site probably null
R2126:Ptprg UTSW 14 12154355 missense probably benign
R2133:Ptprg UTSW 14 12211637 missense probably damaging 1.00
R2471:Ptprg UTSW 14 12210327 missense probably damaging 1.00
R2571:Ptprg UTSW 14 12122135 missense probably benign
R3821:Ptprg UTSW 14 12226375 missense probably benign 0.00
R4196:Ptprg UTSW 14 12122002 missense possibly damaging 0.51
R4392:Ptprg UTSW 14 12142467 missense possibly damaging 0.80
R4665:Ptprg UTSW 14 12215288 missense possibly damaging 0.90
R4730:Ptprg UTSW 14 12213713 missense probably damaging 1.00
R4737:Ptprg UTSW 14 12226314 missense probably damaging 1.00
R4764:Ptprg UTSW 14 12122068 missense probably benign 0.01
R4801:Ptprg UTSW 14 11554233 utr 5 prime probably benign
R4825:Ptprg UTSW 14 12220654 missense probably damaging 1.00
R4960:Ptprg UTSW 14 12237837 missense probably benign 0.07
R4972:Ptprg UTSW 14 12226427 missense possibly damaging 0.94
R4980:Ptprg UTSW 14 12154421 missense probably benign 0.16
R5004:Ptprg UTSW 14 12220667 missense probably damaging 1.00
R5058:Ptprg UTSW 14 12037387 missense possibly damaging 0.82
R5182:Ptprg UTSW 14 12154174 missense probably benign
R5258:Ptprg UTSW 14 12142431 missense probably benign 0.11
R5338:Ptprg UTSW 14 12154111 missense probably benign
R5353:Ptprg UTSW 14 11554235 utr 5 prime probably benign
R5373:Ptprg UTSW 14 12213665 missense probably benign 0.00
R5387:Ptprg UTSW 14 12153873 missense probably damaging 1.00
R5616:Ptprg UTSW 14 12122120 missense probably benign
R5623:Ptprg UTSW 14 12153857 missense probably damaging 1.00
R5976:Ptprg UTSW 14 12211625 missense probably damaging 0.96
R6027:Ptprg UTSW 14 12220613 missense possibly damaging 0.87
R6091:Ptprg UTSW 14 12215979 missense probably damaging 1.00
R6184:Ptprg UTSW 14 12153943 missense probably benign 0.00
R6234:Ptprg UTSW 14 12213747 missense probably damaging 1.00
R6318:Ptprg UTSW 14 12237118 missense probably damaging 1.00
R6324:Ptprg UTSW 14 12226314 missense probably damaging 1.00
R6334:Ptprg UTSW 14 12166832 missense probably damaging 1.00
R6646:Ptprg UTSW 14 11962714 missense probably damaging 1.00
R6647:Ptprg UTSW 14 11962714 missense probably damaging 1.00
R6992:Ptprg UTSW 14 11962602 missense probably damaging 1.00
R7088:Ptprg UTSW 14 12207365 missense probably damaging 1.00
R7250:Ptprg UTSW 14 12166767 missense probably benign 0.18
R7342:Ptprg UTSW 14 12237151 missense possibly damaging 0.90
R7358:Ptprg UTSW 14 12154198 missense possibly damaging 0.59
R7410:Ptprg UTSW 14 11962657 missense probably damaging 1.00
R7448:Ptprg UTSW 14 12142461 missense probably benign 0.12
R7514:Ptprg UTSW 14 12179342 missense possibly damaging 0.86
R7523:Ptprg UTSW 14 12237130 missense probably damaging 0.97
R7672:Ptprg UTSW 14 12211668 missense probably benign 0.04
R7709:Ptprg UTSW 14 12226452 missense probably damaging 1.00
R7720:Ptprg UTSW 14 12211703 missense probably benign 0.31
X0020:Ptprg UTSW 14 12110070 frame shift probably null
X0027:Ptprg UTSW 14 12110070 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTCTTACCTCAGCACCAGAG -3'
(R):5'- AAAGTTCTGCAAGCCAGTCC -3'

Sequencing Primer
(F):5'- CTAACGCTAGCCATTTTTGCATATG -3'
(R):5'- GTCCCAGCCATTGAGAATCC -3'
Posted On2014-09-17