Incidental Mutation 'R2125:Pdzd2'
ID229799
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene NamePDZ domain containing 2
SynonymsPdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
MMRRC Submission 040128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R2125 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location12359711-12739924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12373590 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 2153 (V2153E)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
Predicted Effect probably benign
Transcript: ENSMUST00000075317
AA Change: V2153E

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: V2153E

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,158,022 Y2265F probably benign Het
Aadac A G 3: 60,039,645 T255A possibly damaging Het
Abcb10 A C 8: 123,965,092 V378G probably benign Het
Ackr2 C T 9: 121,908,786 R76* probably null Het
Acly T C 11: 100,523,496 T35A probably benign Het
Acp7 A C 7: 28,629,549 F69V probably damaging Het
Acsl3 T A 1: 78,681,961 I110N probably damaging Het
Adam5 C T 8: 24,815,118 V107M probably damaging Het
Adck2 T C 6: 39,575,142 V281A probably benign Het
Adgrv1 A G 13: 81,419,535 V5173A probably benign Het
Adgrv1 A T 13: 81,419,950 S5035T probably benign Het
AI314180 T C 4: 58,833,978 H834R probably benign Het
Arl10 T A 13: 54,579,124 probably null Het
B3gnt3 A G 8: 71,693,358 W176R probably damaging Het
B4galt4 T C 16: 38,765,938 I3T probably damaging Het
Casr T C 16: 36,495,252 I819V possibly damaging Het
Cdh1 T C 8: 106,656,840 V237A probably damaging Het
Col22a1 G A 15: 71,848,577 R605C unknown Het
Crlf3 A G 11: 80,059,255 V183A probably benign Het
Crtac1 C A 19: 42,323,732 V181L probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 A T 14: 26,724,458 R725* probably null Het
Dnhd1 A T 7: 105,677,971 H709L probably benign Het
Dopey1 A G 9: 86,521,046 Y1431C probably damaging Het
Eif2ak4 A T 2: 118,422,123 H392L probably benign Het
Entpd3 T C 9: 120,555,654 I99T probably damaging Het
Epha6 T C 16: 59,682,688 D952G probably damaging Het
Exoc6 T C 19: 37,590,941 L429P probably damaging Het
F13a1 A G 13: 36,892,841 S625P probably benign Het
Fcho2 T C 13: 98,775,898 N240S possibly damaging Het
Fcrl6 C T 1: 172,599,248 V44M probably benign Het
Fmo6 A T 1: 162,929,958 M82K possibly damaging Het
Gabrr2 T G 4: 33,095,548 I479R probably damaging Het
Gm14409 C A 2: 177,265,402 C101F probably damaging Het
Gnl2 T A 4: 125,053,485 F633L probably benign Het
Greb1l C T 18: 10,511,422 S648F probably damaging Het
Gsap T A 5: 21,242,813 C290S probably damaging Het
Gusb A G 5: 129,999,447 V268A probably benign Het
H2-D1 G A 17: 35,264,115 probably null Het
Hebp2 T A 10: 18,541,260 E164D probably benign Het
Higd1a A T 9: 121,850,247 I58N probably damaging Het
Hoxc13 G T 15: 102,927,223 R262L probably damaging Het
Ifih1 A G 2: 62,623,467 V218A probably benign Het
Impg2 T A 16: 56,265,064 Y1045N probably damaging Het
Kcnk1 A G 8: 125,995,656 E66G probably damaging Het
Klkb1 A G 8: 45,275,504 V406A possibly damaging Het
Klra10 G A 6: 130,279,278 R138W probably damaging Het
Lama2 A C 10: 27,044,453 Y193* probably null Het
Larp7 T C 3: 127,543,130 T428A probably benign Het
Lipg T C 18: 74,945,885 N432S probably benign Het
Loxl1 T C 9: 58,293,712 D489G probably damaging Het
Lrguk A G 6: 34,092,902 K571E probably benign Het
Map3k13 C T 16: 21,892,144 T59I probably benign Het
Mertk T A 2: 128,762,138 D397E probably benign Het
Mgat3 G A 15: 80,211,886 V305I probably benign Het
Mkl2 T C 16: 13,400,804 V449A possibly damaging Het
Mybpc1 G A 10: 88,573,437 Q66* probably null Het
Myo3a A G 2: 22,578,174 D480G probably benign Het
Ndufaf3 C T 9: 108,566,737 R31Q probably benign Het
Neb T C 2: 52,310,638 Y343C probably damaging Het
Nrxn3 A G 12: 89,260,520 probably null Het
Olfr1090 A T 2: 86,754,452 N95K probably benign Het
Olfr1257 A G 2: 89,881,638 M271V probably benign Het
Pcsk4 T C 10: 80,323,879 M379V probably benign Het
Pkd2l1 T C 19: 44,154,500 D427G possibly damaging Het
Plcd4 A G 1: 74,565,152 Y763C probably damaging Het
Plekhh1 T C 12: 79,079,000 F1270S probably damaging Het
Pmfbp1 T C 8: 109,520,273 V259A probably damaging Het
Ptprg T C 14: 12,179,283 S767P possibly damaging Het
Rabl3 T G 16: 37,556,813 probably null Het
Rffl T A 11: 82,818,438 H53L probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rtl1 C T 12: 109,593,921 V495I possibly damaging Het
Scaf11 A T 15: 96,419,315 D789E possibly damaging Het
Scn2a T A 2: 65,752,079 Y1590* probably null Het
Siglech T A 7: 55,771,686 F190I probably benign Het
Slc22a22 C A 15: 57,254,240 A302S probably damaging Het
Slc46a3 T A 5: 147,879,144 T458S probably benign Het
Spta1 G T 1: 174,208,344 R1072L possibly damaging Het
Tbx5 A G 5: 119,836,923 T4A probably benign Het
Tdrd5 T C 1: 156,276,573 R528G probably damaging Het
Tfip11 T C 5: 112,335,663 V648A possibly damaging Het
Thumpd3 T C 6: 113,066,788 V388A probably benign Het
Tmem131l C T 3: 83,942,751 probably null Het
Ttf2 C A 3: 100,948,193 Q895H possibly damaging Het
Ttn A T 2: 76,890,092 probably null Het
Vmn2r13 A G 5: 109,158,192 S507P probably benign Het
Vtn A G 11: 78,500,223 T210A probably damaging Het
Znhit2 A G 19: 6,062,061 T279A probably benign Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12399288 missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12385439 missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12373829 missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12373900 missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12375793 missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12385711 missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12592408 nonsense probably null
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5704:Pdzd2 UTSW 15 12385675 missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 unclassified probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12457859 missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12372561 missense probably benign 0.13
R7014:Pdzd2 UTSW 15 12372975 missense probably benign 0.14
R7110:Pdzd2 UTSW 15 12368013 missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12376123 missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12372973 missense probably benign 0.01
R7228:Pdzd2 UTSW 15 12458145 nonsense probably null
R7317:Pdzd2 UTSW 15 12592243 missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12437162 missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12399205 missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12372734 missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12373203 missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12407336 missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12373374 missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12374016 missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12385786 missense possibly damaging 0.60
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCCACTCATTGCAGTGAC -3'
(R):5'- TCAGGAGAAGAGTTCGGTCC -3'

Sequencing Primer
(F):5'- ACTCATTGCAGTGACCTGGG -3'
(R):5'- AAGAGTTCGGTCCGACTCAG -3'
Posted On2014-09-17