Mutagenetix > Incidental Mutation

Incidental Mutation 'R2125:Greb1l'

229816

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

040128-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2125 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 10511422 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 648 (S648F)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]

AlphaFold

B9EJV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000048977
AA Change: S648F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: S648F

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172532
AA Change: S539F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: S539F

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172680
AA Change: S49F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942
AA Change: S49F

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174553

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	A	T	7: 28,158,022	Y2265F	probably benign	Het
Aadac	A	G	3: 60,039,645	T255A	possibly damaging	Het
Abcb10	A	C	8: 123,965,092	V378G	probably benign	Het
Ackr2	C	T	9: 121,908,786	R76*	probably null	Het
Acly	T	C	11: 100,523,496	T35A	probably benign	Het
Acp7	A	C	7: 28,629,549	F69V	probably damaging	Het
Acsl3	T	A	1: 78,681,961	I110N	probably damaging	Het
Adam5	C	T	8: 24,815,118	V107M	probably damaging	Het
Adck2	T	C	6: 39,575,142	V281A	probably benign	Het
Adgrv1	A	G	13: 81,419,535	V5173A	probably benign	Het
Adgrv1	A	T	13: 81,419,950	S5035T	probably benign	Het
AI314180	T	C	4: 58,833,978	H834R	probably benign	Het
Arl10	T	A	13: 54,579,124		probably null	Het
B3gnt3	A	G	8: 71,693,358	W176R	probably damaging	Het
B4galt4	T	C	16: 38,765,938	I3T	probably damaging	Het
Casr	T	C	16: 36,495,252	I819V	possibly damaging	Het
Cdh1	T	C	8: 106,656,840	V237A	probably damaging	Het
Col22a1	G	A	15: 71,848,577	R605C	unknown	Het
Crlf3	A	G	11: 80,059,255	V183A	probably benign	Het
Crtac1	C	A	19: 42,323,732	V181L	probably damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnah12	A	T	14: 26,724,458	R725*	probably null	Het
Dnhd1	A	T	7: 105,677,971	H709L	probably benign	Het
Dopey1	A	G	9: 86,521,046	Y1431C	probably damaging	Het
Eif2ak4	A	T	2: 118,422,123	H392L	probably benign	Het
Entpd3	T	C	9: 120,555,654	I99T	probably damaging	Het
Epha6	T	C	16: 59,682,688	D952G	probably damaging	Het
Exoc6	T	C	19: 37,590,941	L429P	probably damaging	Het
F13a1	A	G	13: 36,892,841	S625P	probably benign	Het
Fcho2	T	C	13: 98,775,898	N240S	possibly damaging	Het
Fcrl6	C	T	1: 172,599,248	V44M	probably benign	Het
Fmo6	A	T	1: 162,929,958	M82K	possibly damaging	Het
Gabrr2	T	G	4: 33,095,548	I479R	probably damaging	Het
Gm14409	C	A	2: 177,265,402	C101F	probably damaging	Het
Gnl2	T	A	4: 125,053,485	F633L	probably benign	Het
Gsap	T	A	5: 21,242,813	C290S	probably damaging	Het
Gusb	A	G	5: 129,999,447	V268A	probably benign	Het
H2-D1	G	A	17: 35,264,115		probably null	Het
Hebp2	T	A	10: 18,541,260	E164D	probably benign	Het
Higd1a	A	T	9: 121,850,247	I58N	probably damaging	Het
Hoxc13	G	T	15: 102,927,223	R262L	probably damaging	Het
Ifih1	A	G	2: 62,623,467	V218A	probably benign	Het
Impg2	T	A	16: 56,265,064	Y1045N	probably damaging	Het
Kcnk1	A	G	8: 125,995,656	E66G	probably damaging	Het
Klkb1	A	G	8: 45,275,504	V406A	possibly damaging	Het
Klra10	G	A	6: 130,279,278	R138W	probably damaging	Het
Lama2	A	C	10: 27,044,453	Y193*	probably null	Het
Larp7	T	C	3: 127,543,130	T428A	probably benign	Het
Lipg	T	C	18: 74,945,885	N432S	probably benign	Het
Loxl1	T	C	9: 58,293,712	D489G	probably damaging	Het
Lrguk	A	G	6: 34,092,902	K571E	probably benign	Het
Map3k13	C	T	16: 21,892,144	T59I	probably benign	Het
Mertk	T	A	2: 128,762,138	D397E	probably benign	Het
Mgat3	G	A	15: 80,211,886	V305I	probably benign	Het
Mkl2	T	C	16: 13,400,804	V449A	possibly damaging	Het
Mybpc1	G	A	10: 88,573,437	Q66*	probably null	Het
Myo3a	A	G	2: 22,578,174	D480G	probably benign	Het
Ndufaf3	C	T	9: 108,566,737	R31Q	probably benign	Het
Neb	T	C	2: 52,310,638	Y343C	probably damaging	Het
Nrxn3	A	G	12: 89,260,520		probably null	Het
Olfr1090	A	T	2: 86,754,452	N95K	probably benign	Het
Olfr1257	A	G	2: 89,881,638	M271V	probably benign	Het
Pcsk4	T	C	10: 80,323,879	M379V	probably benign	Het
Pdzd2	A	T	15: 12,373,590	V2153E	probably benign	Het
Pkd2l1	T	C	19: 44,154,500	D427G	possibly damaging	Het
Plcd4	A	G	1: 74,565,152	Y763C	probably damaging	Het
Plekhh1	T	C	12: 79,079,000	F1270S	probably damaging	Het
Pmfbp1	T	C	8: 109,520,273	V259A	probably damaging	Het
Ptprg	T	C	14: 12,179,283	S767P	possibly damaging	Het
Rabl3	T	G	16: 37,556,813		probably null	Het
Rffl	T	A	11: 82,818,438	H53L	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rtl1	C	T	12: 109,593,921	V495I	possibly damaging	Het
Scaf11	A	T	15: 96,419,315	D789E	possibly damaging	Het
Scn2a	T	A	2: 65,752,079	Y1590*	probably null	Het
Siglech	T	A	7: 55,771,686	F190I	probably benign	Het
Slc22a22	C	A	15: 57,254,240	A302S	probably damaging	Het
Slc46a3	T	A	5: 147,879,144	T458S	probably benign	Het
Spta1	G	T	1: 174,208,344	R1072L	possibly damaging	Het
Tbx5	A	G	5: 119,836,923	T4A	probably benign	Het
Tdrd5	T	C	1: 156,276,573	R528G	probably damaging	Het
Tfip11	T	C	5: 112,335,663	V648A	possibly damaging	Het
Thumpd3	T	C	6: 113,066,788	V388A	probably benign	Het
Tmem131l	C	T	3: 83,942,751		probably null	Het
Ttf2	C	A	3: 100,948,193	Q895H	possibly damaging	Het
Ttn	A	T	2: 76,890,092		probably null	Het
Vmn2r13	A	G	5: 109,158,192	S507P	probably benign	Het
Vtn	A	G	11: 78,500,223	T210A	probably damaging	Het
Znhit2	A	G	19: 6,062,061	T279A	probably benign	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCCAGCTGCATCAATTGG -3'
(R):5'- GGCTCTTACTAAGGAGAGGACTG -3'

Sequencing Primer
(F):5'- CCAGCTGCATCAATTGGATACTG -3'
(R):5'- CTCTTACTAAGGAGAGGACTGCACAG -3'

Posted On

2014-09-17