Incidental Mutation 'R2126:Axdnd1'
ID 229835
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Name axonemal dynein light chain domain containing 1
Synonyms 9430070O13Rik, LOC381304
MMRRC Submission 040129-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R2126 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 156157985-156248743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 156160784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 164 (N164K)
Ref Sequence ENSEMBL: ENSMUSP00000148583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000212747] [ENSMUST00000213088]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000177824
AA Change: N787K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: N787K

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178036
AA Change: N889K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: N889K

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212342
Predicted Effect probably benign
Transcript: ENSMUST00000212747
AA Change: N164K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect unknown
Transcript: ENSMUST00000213088
AA Change: N1000K
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A G 3: 59,947,066 (GRCm39) T255A possibly damaging Het
Acat3 C T 17: 13,146,294 (GRCm39) A230T probably benign Het
Acsl1 C A 8: 46,986,663 (GRCm39) P650Q probably benign Het
Adgrl3 T A 5: 81,660,383 (GRCm39) I316N probably damaging Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
AI429214 T A 8: 37,461,362 (GRCm39) V170E probably benign Het
Akap13 G A 7: 75,375,052 (GRCm39) G1895S possibly damaging Het
Alpk2 G A 18: 65,483,439 (GRCm39) Q190* probably null Het
Aox3 C A 1: 58,197,375 (GRCm39) Q574K probably benign Het
Apeh A G 9: 107,962,866 (GRCm39) Y702H probably damaging Het
Aqp11 A G 7: 97,386,692 (GRCm39) I151T probably benign Het
Arhgap28 A G 17: 68,176,010 (GRCm39) V363A possibly damaging Het
Arhgef18 A G 8: 3,501,939 (GRCm39) N699S probably damaging Het
Asnsd1 A G 1: 53,386,476 (GRCm39) S384P probably benign Het
Atl1 G T 12: 69,978,431 (GRCm39) probably null Het
Atp13a2 A T 4: 140,722,702 (GRCm39) D203V possibly damaging Het
Bnipl T A 3: 95,152,994 (GRCm39) I162F probably damaging Het
Cacna1d A T 14: 29,845,120 (GRCm39) L655I probably damaging Het
Canx T C 11: 50,195,185 (GRCm39) I294M probably damaging Het
Casz1 T C 4: 149,030,521 (GRCm39) F1180S probably damaging Het
Cav3 T C 6: 112,449,344 (GRCm39) Y121H probably benign Het
Cd4 A C 6: 124,847,499 (GRCm39) S222A probably benign Het
Cds1 T C 5: 101,960,416 (GRCm39) I289T probably benign Het
Cep112 T C 11: 108,399,084 (GRCm39) F328L probably damaging Het
Ces4a G A 8: 105,864,729 (GRCm39) G69S probably damaging Het
Cfap44 A T 16: 44,230,838 (GRCm39) D273V probably benign Het
Cfap91 T C 16: 38,162,124 (GRCm39) T6A probably benign Het
Clec7a C T 6: 129,447,918 (GRCm39) G49D probably benign Het
Col22a1 G A 15: 71,729,102 (GRCm39) Q599* probably null Het
Col6a5 T A 9: 105,822,799 (GRCm39) H186L unknown Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dnah12 A T 14: 26,445,613 (GRCm39) R725* probably null Het
Dnajc10 G A 2: 80,181,078 (GRCm39) probably null Het
Edem3 A T 1: 151,670,482 (GRCm39) H337L possibly damaging Het
Eif2ak4 A T 2: 118,252,604 (GRCm39) H392L probably benign Het
Ercc6l2 G A 13: 63,996,585 (GRCm39) V365I probably damaging Het
Fan1 T C 7: 63,996,636 (GRCm39) E978G probably damaging Het
Fcrl6 C T 1: 172,426,815 (GRCm39) V44M probably benign Het
Gaa G A 11: 119,161,108 (GRCm39) W50* probably null Het
Gm10032 T C 14: 67,030,227 (GRCm39) noncoding transcript Het
Gm10985 CTCTAT CT 3: 53,752,670 (GRCm39) probably null Het
Gprc5b G T 7: 118,583,398 (GRCm39) P157Q probably damaging Het
Gsdmc3 G A 15: 63,730,383 (GRCm39) Q394* probably null Het
Gucd1 A G 10: 75,347,922 (GRCm39) S38P probably damaging Het
Higd1a A T 9: 121,679,313 (GRCm39) I58N probably damaging Het
Hmx3 G C 7: 131,146,278 (GRCm39) V329L possibly damaging Het
Hnrnpul2 A T 19: 8,801,802 (GRCm39) R337* probably null Het
Idua T A 5: 108,829,304 (GRCm39) H368Q possibly damaging Het
Ifih1 A G 2: 62,453,811 (GRCm39) V218A probably benign Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Kif1b G A 4: 149,272,097 (GRCm39) S1568L possibly damaging Het
Klhl30 T A 1: 91,286,499 (GRCm39) probably null Het
Lasp1 T A 11: 97,726,960 (GRCm39) D227E probably benign Het
Lhx6 A G 2: 35,981,336 (GRCm39) I85T possibly damaging Het
Limch1 A G 5: 67,187,103 (GRCm39) D840G probably damaging Het
Loxl4 C G 19: 42,592,402 (GRCm39) E385D probably damaging Het
Lrrtm4 A T 6: 79,998,722 (GRCm39) I44F probably damaging Het
Ltbp2 T C 12: 84,832,483 (GRCm39) probably null Het
Lyg1 T C 1: 37,989,755 (GRCm39) Y44C probably damaging Het
Map1a A G 2: 121,129,122 (GRCm39) I129V probably damaging Het
Med27 C T 2: 29,414,442 (GRCm39) Q150* probably null Het
Ms4a5 A T 19: 11,256,732 (GRCm39) I55N probably damaging Het
Muc5ac T C 7: 141,364,479 (GRCm39) S2597P possibly damaging Het
Mxd1 A C 6: 86,628,422 (GRCm39) probably null Het
Myo3a A G 2: 22,468,186 (GRCm39) D480G probably benign Het
Neb T C 2: 52,200,650 (GRCm39) Y343C probably damaging Het
Niban1 A C 1: 151,571,886 (GRCm39) E277A probably damaging Het
Niban1 A G 1: 151,584,884 (GRCm39) I494V possibly damaging Het
Nrn1 A C 13: 36,914,180 (GRCm39) V34G probably damaging Het
Or4k52 A G 2: 111,610,841 (GRCm39) M59V probably damaging Het
Or4n5 A G 14: 50,132,524 (GRCm39) I245T probably benign Het
Or52b1 C T 7: 104,978,459 (GRCm39) W313* probably null Het
Or56a3 A G 7: 104,735,822 (GRCm39) T300A probably damaging Het
Or8b39 G T 9: 37,996,572 (GRCm39) V147L probably benign Het
Or8h9 T C 2: 86,789,442 (GRCm39) Y120C possibly damaging Het
Or8k40 A T 2: 86,584,796 (GRCm39) N95K probably benign Het
Pdia4 A T 6: 47,773,771 (GRCm39) V526E probably damaging Het
Pdia6 T C 12: 17,328,546 (GRCm39) V167A probably damaging Het
Pgk2 A G 17: 40,518,400 (GRCm39) F343L probably damaging Het
Piwil1 T C 5: 128,831,160 (GRCm39) V827A probably damaging Het
Plag1 A T 4: 3,904,169 (GRCm39) Y341N possibly damaging Het
Plch2 T C 4: 155,083,456 (GRCm39) E393G probably damaging Het
Ptprg T A 14: 12,154,355 (GRCm38) M692K probably benign Het
Rassf8 G A 6: 145,760,908 (GRCm39) R78H probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rnf213 A G 11: 119,341,027 (GRCm39) Q3556R probably damaging Het
Rpa2 T C 4: 132,496,099 (GRCm39) probably null Het
Rpe T G 1: 66,755,139 (GRCm39) F174V possibly damaging Het
Sbf2 T C 7: 110,159,502 (GRCm39) D36G probably damaging Het
Scn2a T A 2: 65,582,423 (GRCm39) Y1590* probably null Het
Slc24a4 T C 12: 102,189,018 (GRCm39) V151A probably damaging Het
Slc30a8 A T 15: 52,159,330 (GRCm39) M17L probably benign Het
Slit3 T C 11: 35,579,506 (GRCm39) Y1228H probably damaging Het
Smad4 G A 18: 73,795,815 (GRCm39) T193M probably benign Het
Smtn T A 11: 3,480,045 (GRCm39) H392L probably benign Het
St8sia3 A G 18: 64,402,745 (GRCm39) D128G probably damaging Het
Sucla2 A T 14: 73,830,108 (GRCm39) M382L possibly damaging Het
Tbx5 A G 5: 119,974,988 (GRCm39) T4A probably benign Het
Tdrd5 T C 1: 156,104,143 (GRCm39) R528G probably damaging Het
Tex44 T C 1: 86,354,811 (GRCm39) L240P probably benign Het
Tns4 A T 11: 98,970,904 (GRCm39) probably null Het
Trappc10 A T 10: 78,039,758 (GRCm39) V731E possibly damaging Het
Ttf1 A G 2: 28,961,357 (GRCm39) K582E probably damaging Het
Ttf2 C A 3: 100,855,509 (GRCm39) Q895H possibly damaging Het
Ttll6 A G 11: 96,038,358 (GRCm39) E402G probably damaging Het
Ttn A T 2: 76,720,436 (GRCm39) probably null Het
Ugt8a T C 3: 125,669,195 (GRCm39) D303G probably damaging Het
Ulk1 G T 5: 110,940,302 (GRCm39) A373D probably benign Het
Vmn2r13 A G 5: 109,306,058 (GRCm39) S507P probably benign Het
Vmn2r19 T A 6: 123,293,033 (GRCm39) D358E possibly damaging Het
Vmn2r88 T C 14: 51,651,264 (GRCm39) S201P probably benign Het
Zfp36l2 A G 17: 84,494,403 (GRCm39) F78S probably damaging Het
Zfp454 A C 11: 50,764,822 (GRCm39) S203R probably benign Het
Zfp616 C A 11: 73,976,229 (GRCm39) Q833K probably benign Het
Znhit2 A G 19: 6,112,091 (GRCm39) T279A probably benign Het
Zswim3 T A 2: 164,661,913 (GRCm39) I131N probably benign Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156,204,233 (GRCm39) missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156,223,012 (GRCm39) missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156,205,959 (GRCm39) missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156,205,956 (GRCm39) missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156,205,956 (GRCm39) missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156,208,456 (GRCm39) missense possibly damaging 0.73
R1087:Axdnd1 UTSW 1 156,193,259 (GRCm39) missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156,205,950 (GRCm39) critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156,176,530 (GRCm39) missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156,174,271 (GRCm39) missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156,204,114 (GRCm39) missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156,208,344 (GRCm39) splice site probably null
R2163:Axdnd1 UTSW 1 156,219,573 (GRCm39) missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156,245,879 (GRCm39) missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156,193,221 (GRCm39) missense probably benign 0.02
R2568:Axdnd1 UTSW 1 156,220,319 (GRCm39) missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156,169,440 (GRCm39) missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156,169,440 (GRCm39) missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156,208,428 (GRCm39) missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156,246,840 (GRCm39) missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156,159,209 (GRCm39) missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156,204,216 (GRCm39) missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156,223,129 (GRCm39) splice site probably null
R4969:Axdnd1 UTSW 1 156,223,075 (GRCm39) missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156,247,980 (GRCm39) missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156,162,920 (GRCm39) missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156,226,104 (GRCm39) missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156,178,982 (GRCm39) missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156,169,459 (GRCm39) missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156,176,528 (GRCm39) missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156,193,182 (GRCm39) splice site probably null
R6208:Axdnd1 UTSW 1 156,220,426 (GRCm39) intron probably benign
R6369:Axdnd1 UTSW 1 156,220,315 (GRCm39) missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156,208,383 (GRCm39) missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156,158,532 (GRCm39) splice site probably null
R7115:Axdnd1 UTSW 1 156,208,446 (GRCm39) missense
R7203:Axdnd1 UTSW 1 156,209,959 (GRCm39) missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156,210,047 (GRCm39) missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156,245,802 (GRCm39) critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156,204,086 (GRCm39) missense
R7686:Axdnd1 UTSW 1 156,223,034 (GRCm39) nonsense probably null
R7793:Axdnd1 UTSW 1 156,166,313 (GRCm39) critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156,220,371 (GRCm39) nonsense probably null
R7882:Axdnd1 UTSW 1 156,225,023 (GRCm39) missense
R8256:Axdnd1 UTSW 1 156,158,236 (GRCm39) missense unknown
R8348:Axdnd1 UTSW 1 156,245,854 (GRCm39) missense probably benign 0.02
R8971:Axdnd1 UTSW 1 156,219,516 (GRCm39) missense
R9207:Axdnd1 UTSW 1 156,215,616 (GRCm39) missense
R9294:Axdnd1 UTSW 1 156,247,917 (GRCm39) nonsense probably null
R9741:Axdnd1 UTSW 1 156,169,385 (GRCm39) missense probably benign 0.18
X0009:Axdnd1 UTSW 1 156,215,649 (GRCm39) missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156,204,105 (GRCm39) missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156,176,633 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACAGCTGTACAGTTCAC -3'
(R):5'- TGCTATCTGATCACAGGCAATG -3'

Sequencing Primer
(F):5'- AGTTCACTGCCTCTAGCCAATG -3'
(R):5'- GGCAATGCCTGTAGAGTTTTTG -3'
Posted On 2014-09-17