Mutagenetix > Incidental Mutation

Incidental Mutation 'R2126:Myo3a'

229837

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

040129-MU

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2126 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22578174 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 480 (D480G)

Ref Sequence

ENSEMBL: ENSMUSP00000116185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000138863]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000044749
AA Change: D1418G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: D1418G

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000138863
AA Change: D480G

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000116185
Gene: ENSMUSG00000025716
AA Change: D480G

Domain	Start	End	E-Value	Type
Pfam:Myosin_head	1	110	1.7e-28	PFAM
IQ	123	145	2.88e1	SMART
IQ	150	172	9.48e-3	SMART
low complexity region	215	231	N/A	INTRINSIC
low complexity region	421	431	N/A	INTRINSIC
low complexity region	558	567	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149423

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadac	A	G	3: 60,039,645	T255A	possibly damaging	Het
Acat3	C	T	17: 12,927,407	A230T	probably benign	Het
Acsl1	C	A	8: 46,533,626	P650Q	probably benign	Het
Adgrl3	T	A	5: 81,512,536	I316N	probably damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
AI429214	T	A	8: 36,994,208	V170E	probably benign	Het
Akap13	G	A	7: 75,725,304	G1895S	possibly damaging	Het
Alpk2	G	A	18: 65,350,368	Q190*	probably null	Het
Aox3	C	A	1: 58,158,216	Q574K	probably benign	Het
Apeh	A	G	9: 108,085,667	Y702H	probably damaging	Het
Aqp11	A	G	7: 97,737,485	I151T	probably benign	Het
Arhgap28	A	G	17: 67,869,015	V363A	possibly damaging	Het
Arhgef18	A	G	8: 3,451,939	N699S	probably damaging	Het
Asnsd1	A	G	1: 53,347,317	S384P	probably benign	Het
Atl1	G	T	12: 69,931,657		probably null	Het
Atp13a2	A	T	4: 140,995,391	D203V	possibly damaging	Het
Axdnd1	A	T	1: 156,333,214	N164K	probably benign	Het
Bnipl	T	A	3: 95,245,683	I162F	probably damaging	Het
Cacna1d	A	T	14: 30,123,163	L655I	probably damaging	Het
Canx	T	C	11: 50,304,358	I294M	probably damaging	Het
Casz1	T	C	4: 148,946,064	F1180S	probably damaging	Het
Cav3	T	C	6: 112,472,383	Y121H	probably benign	Het
Cd4	A	C	6: 124,870,536	S222A	probably benign	Het
Cds1	T	C	5: 101,812,550	I289T	probably benign	Het
Cep112	T	C	11: 108,508,258	F328L	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap44	A	T	16: 44,410,475	D273V	probably benign	Het
Clec7a	C	T	6: 129,470,955	G49D	probably benign	Het
Col22a1	G	A	15: 71,857,253	Q599*	probably null	Het
Col6a5	T	A	9: 105,945,600	H186L	unknown	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnah12	A	T	14: 26,724,458	R725*	probably null	Het
Dnajc10	G	A	2: 80,350,734		probably null	Het
Edem3	A	T	1: 151,794,731	H337L	possibly damaging	Het
Eif2ak4	A	T	2: 118,422,123	H392L	probably benign	Het
Ercc6l2	G	A	13: 63,848,771	V365I	probably damaging	Het
Fam129a	A	C	1: 151,696,135	E277A	probably damaging	Het
Fam129a	A	G	1: 151,709,133	I494V	possibly damaging	Het
Fan1	T	C	7: 64,346,888	E978G	probably damaging	Het
Fcrl6	C	T	1: 172,599,248	V44M	probably benign	Het
Gaa	G	A	11: 119,270,282	W50*	probably null	Het
Gm10032	T	C	14: 66,792,778		noncoding transcript	Het
Gm10985	CTCTAT	CT	3: 53,845,249		probably null	Het
Gprc5b	G	T	7: 118,984,175	P157Q	probably damaging	Het
Gsdmc3	G	A	15: 63,858,534	Q394*	probably null	Het
Gucd1	A	G	10: 75,512,088	S38P	probably damaging	Het
Higd1a	A	T	9: 121,850,247	I58N	probably damaging	Het
Hmx3	G	C	7: 131,544,549	V329L	possibly damaging	Het
Hnrnpul2	A	T	19: 8,824,438	R337*	probably null	Het
Idua	T	A	5: 108,681,438	H368Q	possibly damaging	Het
Ifih1	A	G	2: 62,623,467	V218A	probably benign	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Klhl30	T	A	1: 91,358,777		probably null	Het
Lasp1	T	A	11: 97,836,134	D227E	probably benign	Het
Lhx6	A	G	2: 36,091,324	I85T	possibly damaging	Het
Limch1	A	G	5: 67,029,760	D840G	probably damaging	Het
Loxl4	C	G	19: 42,603,963	E385D	probably damaging	Het
Lrrtm4	A	T	6: 80,021,739	I44F	probably damaging	Het
Ltbp2	T	C	12: 84,785,709		probably null	Het
Lyg1	T	C	1: 37,950,674	Y44C	probably damaging	Het
Maats1	T	C	16: 38,341,762	T6A	probably benign	Het
Map1a	A	G	2: 121,298,641	I129V	probably damaging	Het
Med27	C	T	2: 29,524,430	Q150*	probably null	Het
Ms4a5	A	T	19: 11,279,368	I55N	probably damaging	Het
Muc5ac	T	C	7: 141,810,742	S2597P	possibly damaging	Het
Mxd1	A	C	6: 86,651,440		probably null	Het
Neb	T	C	2: 52,310,638	Y343C	probably damaging	Het
Nrn1	A	C	13: 36,730,206	V34G	probably damaging	Het
Olfr1090	A	T	2: 86,754,452	N95K	probably benign	Het
Olfr1099	T	C	2: 86,959,098	Y120C	possibly damaging	Het
Olfr1302	A	G	2: 111,780,496	M59V	probably damaging	Het
Olfr679	A	G	7: 105,086,615	T300A	probably damaging	Het
Olfr690	C	T	7: 105,329,252	W313*	probably null	Het
Olfr722	A	G	14: 49,895,067	I245T	probably benign	Het
Olfr887	G	T	9: 38,085,276	V147L	probably benign	Het
Pdia4	A	T	6: 47,796,837	V526E	probably damaging	Het
Pdia6	T	C	12: 17,278,545	V167A	probably damaging	Het
Pgk2	A	G	17: 40,207,509	F343L	probably damaging	Het
Piwil1	T	C	5: 128,754,096	V827A	probably damaging	Het
Plag1	A	T	4: 3,904,169	Y341N	possibly damaging	Het
Plch2	T	C	4: 154,998,999	E393G	probably damaging	Het
Ptprg	T	A	14: 12,154,355	M692K	probably benign	Het
Rassf8	G	A	6: 145,815,182	R78H	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf213	A	G	11: 119,450,201	Q3556R	probably damaging	Het
Rpa2	T	C	4: 132,768,788		probably null	Het
Rpe	T	G	1: 66,715,980	F174V	possibly damaging	Het
Sbf2	T	C	7: 110,560,295	D36G	probably damaging	Het
Scn2a	T	A	2: 65,752,079	Y1590*	probably null	Het
Slc24a4	T	C	12: 102,222,759	V151A	probably damaging	Het
Slc30a8	A	T	15: 52,295,934	M17L	probably benign	Het
Slit3	T	C	11: 35,688,679	Y1228H	probably damaging	Het
Smad4	G	A	18: 73,662,744	T193M	probably benign	Het
Smtn	T	A	11: 3,530,045	H392L	probably benign	Het
St8sia3	A	G	18: 64,269,674	D128G	probably damaging	Het
Sucla2	A	T	14: 73,592,668	M382L	possibly damaging	Het
Tbx5	A	G	5: 119,836,923	T4A	probably benign	Het
Tdrd5	T	C	1: 156,276,573	R528G	probably damaging	Het
Tex44	T	C	1: 86,427,089	L240P	probably benign	Het
Tns4	A	T	11: 99,080,078		probably null	Het
Trappc10	A	T	10: 78,203,924	V731E	possibly damaging	Het
Ttf1	A	G	2: 29,071,345	K582E	probably damaging	Het
Ttf2	C	A	3: 100,948,193	Q895H	possibly damaging	Het
Ttll6	A	G	11: 96,147,532	E402G	probably damaging	Het
Ttn	A	T	2: 76,890,092		probably null	Het
Ugt8a	T	C	3: 125,875,546	D303G	probably damaging	Het
Ulk1	G	T	5: 110,792,436	A373D	probably benign	Het
Vmn2r13	A	G	5: 109,158,192	S507P	probably benign	Het
Vmn2r19	T	A	6: 123,316,074	D358E	possibly damaging	Het
Vmn2r88	T	C	14: 51,413,807	S201P	probably benign	Het
Zfp36l2	A	G	17: 84,186,975	F78S	probably damaging	Het
Zfp454	A	C	11: 50,873,995	S203R	probably benign	Het
Zfp616	C	A	11: 74,085,403	Q833K	probably benign	Het
Znhit2	A	G	19: 6,062,061	T279A	probably benign	Het
Zswim3	T	A	2: 164,819,993	I131N	probably benign	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
R8708:Myo3a	UTSW	2	22291796	splice site	probably benign
R8757:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8759:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8779:Myo3a	UTSW	2	22245593	nonsense	probably null
R8828:Myo3a	UTSW	2	22241053	missense	probably benign	0.01
R8910:Myo3a	UTSW	2	22574268	missense	probably benign	0.01
R8916:Myo3a	UTSW	2	22567692	missense	probably damaging	1.00
R8926:Myo3a	UTSW	2	22396263	missense	possibly damaging	0.95
R9028:Myo3a	UTSW	2	22600087	missense	possibly damaging	0.79
R9046:Myo3a	UTSW	2	22558355	missense	probably damaging	0.99
R9120:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R9153:Myo3a	UTSW	2	22399933	missense	probably benign	0.02
R9191:Myo3a	UTSW	2	22579829	missense	probably benign	0.24
R9258:Myo3a	UTSW	2	22577533	missense	possibly damaging	0.60
R9436:Myo3a	UTSW	2	22407424	nonsense	probably null
R9464:Myo3a	UTSW	2	22227572	start gained	probably benign
R9487:Myo3a	UTSW	2	22241051	missense	probably benign
R9719:Myo3a	UTSW	2	22544455	missense	probably benign	0.02
R9799:Myo3a	UTSW	2	22600169	missense	probably damaging	1.00
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- CATTCATAGCAAATACCAGAGTTCC -3'
(R):5'- TGGGCATAAAAGTACATGGCTAC -3'

Sequencing Primer
(F):5'- TTCCAAGAAAAAGCAACAGCTGG -3'
(R):5'- CAATCCCCCAGCTATTGAT -3'

Posted On

2014-09-17