Incidental Mutation 'R2126:Lhx6'
ID229840
Institutional Source Beutler Lab
Gene Symbol Lhx6
Ensembl Gene ENSMUSG00000026890
Gene NameLIM homeobox protein 6
Synonyms
MMRRC Submission 040129-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock #R2126 (G1)
Quality Score207
Status Not validated
Chromosome2
Chromosomal Location36081953-36105408 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36091324 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 85 (I85T)
Ref Sequence ENSEMBL: ENSMUSP00000135776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112960] [ENSMUST00000112961] [ENSMUST00000112963] [ENSMUST00000112966] [ENSMUST00000112967] [ENSMUST00000136821] [ENSMUST00000148852]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112960
AA Change: I292T

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108584
Gene: ENSMUSG00000026890
AA Change: I292T

DomainStartEndE-ValueType
low complexity region 71 94 N/A INTRINSIC
LIM 98 151 7.34e-13 SMART
LIM 159 213 3.17e-17 SMART
HOX 248 310 1.1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112961
AA Change: I263T

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108585
Gene: ENSMUSG00000026890
AA Change: I263T

DomainStartEndE-ValueType
low complexity region 42 65 N/A INTRINSIC
LIM 69 122 7.34e-13 SMART
LIM 130 184 3.17e-17 SMART
HOX 219 281 1.1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112963
AA Change: I263T

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108587
Gene: ENSMUSG00000026890
AA Change: I263T

DomainStartEndE-ValueType
low complexity region 42 65 N/A INTRINSIC
LIM 69 122 7.34e-13 SMART
LIM 130 184 3.17e-17 SMART
HOX 219 281 1.1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112966
AA Change: I263T

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108590
Gene: ENSMUSG00000026890
AA Change: I263T

DomainStartEndE-ValueType
low complexity region 42 65 N/A INTRINSIC
LIM 69 122 7.34e-13 SMART
LIM 130 184 3.17e-17 SMART
HOX 219 281 1.1e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112967
AA Change: I292T

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108591
Gene: ENSMUSG00000026890
AA Change: I292T

DomainStartEndE-ValueType
low complexity region 71 94 N/A INTRINSIC
LIM 98 151 7.34e-13 SMART
LIM 159 213 3.17e-17 SMART
HOX 248 310 1.1e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136821
AA Change: I85T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135776
Gene: ENSMUSG00000026890
AA Change: I85T

DomainStartEndE-ValueType
LIM 10 64 3.17e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148852
AA Change: I263T

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135693
Gene: ENSMUSG00000026890
AA Change: I263T

DomainStartEndE-ValueType
low complexity region 42 65 N/A INTRINSIC
LIM 69 122 7.34e-13 SMART
LIM 130 184 3.17e-17 SMART
HOX 219 281 1.1e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187180
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large protein family that contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein has tandem LIM domains as well as a DNA-binding homeodomain. The protein functions as a transcription factor involved in embryogenesis and head development and is highly expressed in neural crest derived mesenchyme cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutation of this gene results in impaired migration and specification of cortical interneurons, postnatal lethality and weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A G 3: 60,039,645 T255A possibly damaging Het
Acat3 C T 17: 12,927,407 A230T probably benign Het
Acsl1 C A 8: 46,533,626 P650Q probably benign Het
Adgrl3 T A 5: 81,512,536 I316N probably damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
AI429214 T A 8: 36,994,208 V170E probably benign Het
Akap13 G A 7: 75,725,304 G1895S possibly damaging Het
Alpk2 G A 18: 65,350,368 Q190* probably null Het
Aox3 C A 1: 58,158,216 Q574K probably benign Het
Apeh A G 9: 108,085,667 Y702H probably damaging Het
Aqp11 A G 7: 97,737,485 I151T probably benign Het
Arhgap28 A G 17: 67,869,015 V363A possibly damaging Het
Arhgef18 A G 8: 3,451,939 N699S probably damaging Het
Asnsd1 A G 1: 53,347,317 S384P probably benign Het
Atl1 G T 12: 69,931,657 probably null Het
Atp13a2 A T 4: 140,995,391 D203V possibly damaging Het
Axdnd1 A T 1: 156,333,214 N164K probably benign Het
Bnipl T A 3: 95,245,683 I162F probably damaging Het
Cacna1d A T 14: 30,123,163 L655I probably damaging Het
Canx T C 11: 50,304,358 I294M probably damaging Het
Casz1 T C 4: 148,946,064 F1180S probably damaging Het
Cav3 T C 6: 112,472,383 Y121H probably benign Het
Cd4 A C 6: 124,870,536 S222A probably benign Het
Cds1 T C 5: 101,812,550 I289T probably benign Het
Cep112 T C 11: 108,508,258 F328L probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap44 A T 16: 44,410,475 D273V probably benign Het
Clec7a C T 6: 129,470,955 G49D probably benign Het
Col22a1 G A 15: 71,857,253 Q599* probably null Het
Col6a5 T A 9: 105,945,600 H186L unknown Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 A T 14: 26,724,458 R725* probably null Het
Dnajc10 G A 2: 80,350,734 probably null Het
Edem3 A T 1: 151,794,731 H337L possibly damaging Het
Eif2ak4 A T 2: 118,422,123 H392L probably benign Het
Ercc6l2 G A 13: 63,848,771 V365I probably damaging Het
Fam129a A C 1: 151,696,135 E277A probably damaging Het
Fam129a A G 1: 151,709,133 I494V possibly damaging Het
Fan1 T C 7: 64,346,888 E978G probably damaging Het
Fcrl6 C T 1: 172,599,248 V44M probably benign Het
Gaa G A 11: 119,270,282 W50* probably null Het
Gm10032 T C 14: 66,792,778 noncoding transcript Het
Gm10985 CTCTAT CT 3: 53,845,249 probably null Het
Gprc5b G T 7: 118,984,175 P157Q probably damaging Het
Gsdmc3 G A 15: 63,858,534 Q394* probably null Het
Gucd1 A G 10: 75,512,088 S38P probably damaging Het
Higd1a A T 9: 121,850,247 I58N probably damaging Het
Hmx3 G C 7: 131,544,549 V329L possibly damaging Het
Hnrnpul2 A T 19: 8,824,438 R337* probably null Het
Idua T A 5: 108,681,438 H368Q possibly damaging Het
Ifih1 A G 2: 62,623,467 V218A probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl30 T A 1: 91,358,777 probably null Het
Lasp1 T A 11: 97,836,134 D227E probably benign Het
Limch1 A G 5: 67,029,760 D840G probably damaging Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrrtm4 A T 6: 80,021,739 I44F probably damaging Het
Ltbp2 T C 12: 84,785,709 probably null Het
Lyg1 T C 1: 37,950,674 Y44C probably damaging Het
Maats1 T C 16: 38,341,762 T6A probably benign Het
Map1a A G 2: 121,298,641 I129V probably damaging Het
Med27 C T 2: 29,524,430 Q150* probably null Het
Ms4a5 A T 19: 11,279,368 I55N probably damaging Het
Muc5ac T C 7: 141,810,742 S2597P possibly damaging Het
Mxd1 A C 6: 86,651,440 probably null Het
Myo3a A G 2: 22,578,174 D480G probably benign Het
Neb T C 2: 52,310,638 Y343C probably damaging Het
Nrn1 A C 13: 36,730,206 V34G probably damaging Het
Olfr1090 A T 2: 86,754,452 N95K probably benign Het
Olfr1099 T C 2: 86,959,098 Y120C possibly damaging Het
Olfr1302 A G 2: 111,780,496 M59V probably damaging Het
Olfr679 A G 7: 105,086,615 T300A probably damaging Het
Olfr690 C T 7: 105,329,252 W313* probably null Het
Olfr722 A G 14: 49,895,067 I245T probably benign Het
Olfr887 G T 9: 38,085,276 V147L probably benign Het
Pdia4 A T 6: 47,796,837 V526E probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Pgk2 A G 17: 40,207,509 F343L probably damaging Het
Piwil1 T C 5: 128,754,096 V827A probably damaging Het
Plag1 A T 4: 3,904,169 Y341N possibly damaging Het
Plch2 T C 4: 154,998,999 E393G probably damaging Het
Ptprg T A 14: 12,154,355 M692K probably benign Het
Rassf8 G A 6: 145,815,182 R78H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,450,201 Q3556R probably damaging Het
Rpa2 T C 4: 132,768,788 probably null Het
Rpe T G 1: 66,715,980 F174V possibly damaging Het
Sbf2 T C 7: 110,560,295 D36G probably damaging Het
Scn2a T A 2: 65,752,079 Y1590* probably null Het
Slc24a4 T C 12: 102,222,759 V151A probably damaging Het
Slc30a8 A T 15: 52,295,934 M17L probably benign Het
Slit3 T C 11: 35,688,679 Y1228H probably damaging Het
Smad4 G A 18: 73,662,744 T193M probably benign Het
Smtn T A 11: 3,530,045 H392L probably benign Het
St8sia3 A G 18: 64,269,674 D128G probably damaging Het
Sucla2 A T 14: 73,592,668 M382L possibly damaging Het
Tbx5 A G 5: 119,836,923 T4A probably benign Het
Tdrd5 T C 1: 156,276,573 R528G probably damaging Het
Tex44 T C 1: 86,427,089 L240P probably benign Het
Tns4 A T 11: 99,080,078 probably null Het
Trappc10 A T 10: 78,203,924 V731E possibly damaging Het
Ttf1 A G 2: 29,071,345 K582E probably damaging Het
Ttf2 C A 3: 100,948,193 Q895H possibly damaging Het
Ttll6 A G 11: 96,147,532 E402G probably damaging Het
Ttn A T 2: 76,890,092 probably null Het
Ugt8a T C 3: 125,875,546 D303G probably damaging Het
Ulk1 G T 5: 110,792,436 A373D probably benign Het
Vmn2r13 A G 5: 109,158,192 S507P probably benign Het
Vmn2r19 T A 6: 123,316,074 D358E possibly damaging Het
Vmn2r88 T C 14: 51,413,807 S201P probably benign Het
Zfp36l2 A G 17: 84,186,975 F78S probably damaging Het
Zfp454 A C 11: 50,873,995 S203R probably benign Het
Zfp616 C A 11: 74,085,403 Q833K probably benign Het
Znhit2 A G 19: 6,062,061 T279A probably benign Het
Zswim3 T A 2: 164,819,993 I131N probably benign Het
Other mutations in Lhx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Lhx6 APN 2 36091716 splice site probably benign
IGL01391:Lhx6 APN 2 36103465 missense probably benign 0.00
IGL01413:Lhx6 APN 2 36103516 missense probably benign 0.24
IGL03154:Lhx6 APN 2 36094443 splice site probably null
R1546:Lhx6 UTSW 2 36091037 missense probably benign 0.00
R1630:Lhx6 UTSW 2 36102901 missense probably damaging 1.00
R1785:Lhx6 UTSW 2 36087458 nonsense probably null
R1786:Lhx6 UTSW 2 36087458 nonsense probably null
R1792:Lhx6 UTSW 2 36087375 missense probably damaging 1.00
R2145:Lhx6 UTSW 2 36087466 missense probably benign 0.01
R2167:Lhx6 UTSW 2 36103359 missense probably damaging 1.00
R2393:Lhx6 UTSW 2 36091390 missense probably benign 0.22
R5102:Lhx6 UTSW 2 36094210 splice site probably null
R5418:Lhx6 UTSW 2 36087366 critical splice donor site probably null
R6735:Lhx6 UTSW 2 36091378 missense probably damaging 0.99
R7462:Lhx6 UTSW 2 36084071 missense possibly damaging 0.86
R7546:Lhx6 UTSW 2 36103345 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGCACTCTCAGTAATCAAGGAAAAG -3'
(R):5'- TGTTCGGGACTTGTGACTCC -3'

Sequencing Primer
(F):5'- CTCAGTAATCAAGGAAAAGGGTCAAC -3'
(R):5'- CCGCTCCAAGGATGAAGCTG -3'
Posted On2014-09-17