Mutagenetix > Incidental Mutation

Incidental Mutation 'R2126:Rif1'

229841

Institutional Source

Beutler Lab

Gene Symbol

Rif1

Ensembl Gene

ENSMUSG00000036202

Gene Name

replication timing regulatory factor 1

Synonyms

6530403D07Rik, 5730435J01Rik, D2Ertd145e

MMRRC Submission

040129-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2126 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

52072832-52122383 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

GCCACCA to GCCA at 52110324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069794
AA Change: 1264

SMART Domains

Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: 1264

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	22	368	3.3e-78	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112693
AA Change: P1264

SMART Domains

Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: P1264

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	18	381	1.4e-85	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125322

Predicted Effect

probably benign
Transcript: ENSMUST00000125376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145130

Predicted Effect

probably benign
Transcript: ENSMUST00000152178

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadac	A	G	3: 60,039,645	T255A	possibly damaging	Het
Acat3	C	T	17: 12,927,407	A230T	probably benign	Het
Acsl1	C	A	8: 46,533,626	P650Q	probably benign	Het
Adgrl3	T	A	5: 81,512,536	I316N	probably damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
AI429214	T	A	8: 36,994,208	V170E	probably benign	Het
Akap13	G	A	7: 75,725,304	G1895S	possibly damaging	Het
Alpk2	G	A	18: 65,350,368	Q190*	probably null	Het
Aox3	C	A	1: 58,158,216	Q574K	probably benign	Het
Apeh	A	G	9: 108,085,667	Y702H	probably damaging	Het
Aqp11	A	G	7: 97,737,485	I151T	probably benign	Het
Arhgap28	A	G	17: 67,869,015	V363A	possibly damaging	Het
Arhgef18	A	G	8: 3,451,939	N699S	probably damaging	Het
Asnsd1	A	G	1: 53,347,317	S384P	probably benign	Het
Atl1	G	T	12: 69,931,657		probably null	Het
Atp13a2	A	T	4: 140,995,391	D203V	possibly damaging	Het
Axdnd1	A	T	1: 156,333,214	N164K	probably benign	Het
Bnipl	T	A	3: 95,245,683	I162F	probably damaging	Het
Cacna1d	A	T	14: 30,123,163	L655I	probably damaging	Het
Canx	T	C	11: 50,304,358	I294M	probably damaging	Het
Casz1	T	C	4: 148,946,064	F1180S	probably damaging	Het
Cav3	T	C	6: 112,472,383	Y121H	probably benign	Het
Cd4	A	C	6: 124,870,536	S222A	probably benign	Het
Cds1	T	C	5: 101,812,550	I289T	probably benign	Het
Cep112	T	C	11: 108,508,258	F328L	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap44	A	T	16: 44,410,475	D273V	probably benign	Het
Clec7a	C	T	6: 129,470,955	G49D	probably benign	Het
Col22a1	G	A	15: 71,857,253	Q599*	probably null	Het
Col6a5	T	A	9: 105,945,600	H186L	unknown	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnah12	A	T	14: 26,724,458	R725*	probably null	Het
Dnajc10	G	A	2: 80,350,734		probably null	Het
Edem3	A	T	1: 151,794,731	H337L	possibly damaging	Het
Eif2ak4	A	T	2: 118,422,123	H392L	probably benign	Het
Ercc6l2	G	A	13: 63,848,771	V365I	probably damaging	Het
Fam129a	A	C	1: 151,696,135	E277A	probably damaging	Het
Fam129a	A	G	1: 151,709,133	I494V	possibly damaging	Het
Fan1	T	C	7: 64,346,888	E978G	probably damaging	Het
Fcrl6	C	T	1: 172,599,248	V44M	probably benign	Het
Gaa	G	A	11: 119,270,282	W50*	probably null	Het
Gm10032	T	C	14: 66,792,778		noncoding transcript	Het
Gm10985	CTCTAT	CT	3: 53,845,249		probably null	Het
Gprc5b	G	T	7: 118,984,175	P157Q	probably damaging	Het
Gsdmc3	G	A	15: 63,858,534	Q394*	probably null	Het
Gucd1	A	G	10: 75,512,088	S38P	probably damaging	Het
Higd1a	A	T	9: 121,850,247	I58N	probably damaging	Het
Hmx3	G	C	7: 131,544,549	V329L	possibly damaging	Het
Hnrnpul2	A	T	19: 8,824,438	R337*	probably null	Het
Idua	T	A	5: 108,681,438	H368Q	possibly damaging	Het
Ifih1	A	G	2: 62,623,467	V218A	probably benign	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Klhl30	T	A	1: 91,358,777		probably null	Het
Lasp1	T	A	11: 97,836,134	D227E	probably benign	Het
Lhx6	A	G	2: 36,091,324	I85T	possibly damaging	Het
Limch1	A	G	5: 67,029,760	D840G	probably damaging	Het
Loxl4	C	G	19: 42,603,963	E385D	probably damaging	Het
Lrrtm4	A	T	6: 80,021,739	I44F	probably damaging	Het
Ltbp2	T	C	12: 84,785,709		probably null	Het
Lyg1	T	C	1: 37,950,674	Y44C	probably damaging	Het
Maats1	T	C	16: 38,341,762	T6A	probably benign	Het
Map1a	A	G	2: 121,298,641	I129V	probably damaging	Het
Med27	C	T	2: 29,524,430	Q150*	probably null	Het
Ms4a5	A	T	19: 11,279,368	I55N	probably damaging	Het
Muc5ac	T	C	7: 141,810,742	S2597P	possibly damaging	Het
Mxd1	A	C	6: 86,651,440		probably null	Het
Myo3a	A	G	2: 22,578,174	D480G	probably benign	Het
Neb	T	C	2: 52,310,638	Y343C	probably damaging	Het
Nrn1	A	C	13: 36,730,206	V34G	probably damaging	Het
Olfr1090	A	T	2: 86,754,452	N95K	probably benign	Het
Olfr1099	T	C	2: 86,959,098	Y120C	possibly damaging	Het
Olfr1302	A	G	2: 111,780,496	M59V	probably damaging	Het
Olfr679	A	G	7: 105,086,615	T300A	probably damaging	Het
Olfr690	C	T	7: 105,329,252	W313*	probably null	Het
Olfr722	A	G	14: 49,895,067	I245T	probably benign	Het
Olfr887	G	T	9: 38,085,276	V147L	probably benign	Het
Pdia4	A	T	6: 47,796,837	V526E	probably damaging	Het
Pdia6	T	C	12: 17,278,545	V167A	probably damaging	Het
Pgk2	A	G	17: 40,207,509	F343L	probably damaging	Het
Piwil1	T	C	5: 128,754,096	V827A	probably damaging	Het
Plag1	A	T	4: 3,904,169	Y341N	possibly damaging	Het
Plch2	T	C	4: 154,998,999	E393G	probably damaging	Het
Ptprg	T	A	14: 12,154,355	M692K	probably benign	Het
Rassf8	G	A	6: 145,815,182	R78H	probably benign	Het
Rnf213	A	G	11: 119,450,201	Q3556R	probably damaging	Het
Rpa2	T	C	4: 132,768,788		probably null	Het
Rpe	T	G	1: 66,715,980	F174V	possibly damaging	Het
Sbf2	T	C	7: 110,560,295	D36G	probably damaging	Het
Scn2a	T	A	2: 65,752,079	Y1590*	probably null	Het
Slc24a4	T	C	12: 102,222,759	V151A	probably damaging	Het
Slc30a8	A	T	15: 52,295,934	M17L	probably benign	Het
Slit3	T	C	11: 35,688,679	Y1228H	probably damaging	Het
Smad4	G	A	18: 73,662,744	T193M	probably benign	Het
Smtn	T	A	11: 3,530,045	H392L	probably benign	Het
St8sia3	A	G	18: 64,269,674	D128G	probably damaging	Het
Sucla2	A	T	14: 73,592,668	M382L	possibly damaging	Het
Tbx5	A	G	5: 119,836,923	T4A	probably benign	Het
Tdrd5	T	C	1: 156,276,573	R528G	probably damaging	Het
Tex44	T	C	1: 86,427,089	L240P	probably benign	Het
Tns4	A	T	11: 99,080,078		probably null	Het
Trappc10	A	T	10: 78,203,924	V731E	possibly damaging	Het
Ttf1	A	G	2: 29,071,345	K582E	probably damaging	Het
Ttf2	C	A	3: 100,948,193	Q895H	possibly damaging	Het
Ttll6	A	G	11: 96,147,532	E402G	probably damaging	Het
Ttn	A	T	2: 76,890,092		probably null	Het
Ugt8a	T	C	3: 125,875,546	D303G	probably damaging	Het
Ulk1	G	T	5: 110,792,436	A373D	probably benign	Het
Vmn2r13	A	G	5: 109,158,192	S507P	probably benign	Het
Vmn2r19	T	A	6: 123,316,074	D358E	possibly damaging	Het
Vmn2r88	T	C	14: 51,413,807	S201P	probably benign	Het
Zfp36l2	A	G	17: 84,186,975	F78S	probably damaging	Het
Zfp454	A	C	11: 50,873,995	S203R	probably benign	Het
Zfp616	C	A	11: 74,085,403	Q833K	probably benign	Het
Znhit2	A	G	19: 6,062,061	T279A	probably benign	Het
Zswim3	T	A	2: 164,819,993	I131N	probably benign	Het

Other mutations in Rif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Rif1	APN	2	52121007	missense	probably damaging	0.96
IGL00711:Rif1	APN	2	52111070	missense	probably benign	0.00
IGL00721:Rif1	APN	2	52119117	missense	probably damaging	1.00
IGL01085:Rif1	APN	2	52085140	missense	possibly damaging	0.71
IGL01093:Rif1	APN	2	52095948	missense	probably damaging	1.00
IGL01107:Rif1	APN	2	52111303	missense	probably benign	0.00
IGL01138:Rif1	APN	2	52111522	missense	probably damaging	1.00
IGL01844:Rif1	APN	2	52112543	missense	probably benign	0.07
IGL02441:Rif1	APN	2	52105515	missense	probably benign	0.00
IGL02448:Rif1	APN	2	52116696	missense	probably damaging	0.99
IGL02563:Rif1	APN	2	52077065	missense	probably damaging	1.00
IGL02704:Rif1	APN	2	52093576	missense	probably damaging	1.00
IGL02946:Rif1	APN	2	52110125	nonsense	probably null
IGL03060:Rif1	APN	2	52112137	missense	probably damaging	0.97
IGL03206:Rif1	APN	2	52103622	missense	probably damaging	1.00
IGL03263:Rif1	APN	2	52090261	missense	probably damaging	0.99
IGL03267:Rif1	APN	2	52076988	missense	possibly damaging	0.94
IGL03280:Rif1	APN	2	52112599	missense	probably benign	0.32
hifi	UTSW	2	52110324	unclassified	probably benign
nietzsche	UTSW	2	52077020	missense	probably benign	0.08
PIT4305001:Rif1	UTSW	2	52111958	missense
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0104:Rif1	UTSW	2	52110092	missense	possibly damaging	0.77
R0268:Rif1	UTSW	2	52090286	critical splice donor site	probably null
R0276:Rif1	UTSW	2	52110324	unclassified	probably benign
R0278:Rif1	UTSW	2	52110324	unclassified	probably benign
R0288:Rif1	UTSW	2	52110013	missense	probably damaging	1.00
R0314:Rif1	UTSW	2	52110324	unclassified	probably benign
R0345:Rif1	UTSW	2	52110324	unclassified	probably benign
R0346:Rif1	UTSW	2	52110324	unclassified	probably benign
R0383:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R0384:Rif1	UTSW	2	52110324	unclassified	probably benign
R0387:Rif1	UTSW	2	52110324	unclassified	probably benign
R0388:Rif1	UTSW	2	52110324	unclassified	probably benign
R0456:Rif1	UTSW	2	52110324	unclassified	probably benign
R0477:Rif1	UTSW	2	52110324	unclassified	probably benign
R0505:Rif1	UTSW	2	52110737	missense	probably damaging	0.99
R0510:Rif1	UTSW	2	52110324	unclassified	probably benign
R0511:Rif1	UTSW	2	52110324	unclassified	probably benign
R0512:Rif1	UTSW	2	52110324	unclassified	probably benign
R0633:Rif1	UTSW	2	52112563	missense	probably benign	0.00
R0637:Rif1	UTSW	2	52110324	unclassified	probably benign
R0638:Rif1	UTSW	2	52111588	missense	probably benign	0.12
R0666:Rif1	UTSW	2	52110324	unclassified	probably benign
R0675:Rif1	UTSW	2	52110324	unclassified	probably benign
R0707:Rif1	UTSW	2	52110324	unclassified	probably benign
R0726:Rif1	UTSW	2	52110353	missense	possibly damaging	0.52
R0743:Rif1	UTSW	2	52110324	unclassified	probably benign
R0744:Rif1	UTSW	2	52110324	unclassified	probably benign
R0938:Rif1	UTSW	2	52110324	unclassified	probably benign
R0939:Rif1	UTSW	2	52110324	unclassified	probably benign
R0940:Rif1	UTSW	2	52110324	unclassified	probably benign
R0941:Rif1	UTSW	2	52110324	unclassified	probably benign
R0942:Rif1	UTSW	2	52110324	unclassified	probably benign
R0943:Rif1	UTSW	2	52110324	unclassified	probably benign
R1006:Rif1	UTSW	2	52085029	missense	probably damaging	0.99
R1052:Rif1	UTSW	2	52111562	missense	probably benign	0.01
R1061:Rif1	UTSW	2	52110324	unclassified	probably benign
R1175:Rif1	UTSW	2	52107628	unclassified	probably benign
R1183:Rif1	UTSW	2	52110324	unclassified	probably benign
R1184:Rif1	UTSW	2	52110324	unclassified	probably benign
R1271:Rif1	UTSW	2	52110324	unclassified	probably benign
R1332:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1336:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1351:Rif1	UTSW	2	52111555	missense	possibly damaging	0.74
R1517:Rif1	UTSW	2	52110324	unclassified	probably benign
R1527:Rif1	UTSW	2	52110324	unclassified	probably benign
R1560:Rif1	UTSW	2	52111131	missense	probably damaging	1.00
R1563:Rif1	UTSW	2	52073223	missense	probably damaging	0.99
R1571:Rif1	UTSW	2	52110324	unclassified	probably benign
R1625:Rif1	UTSW	2	52103640	missense	probably benign	0.25
R1679:Rif1	UTSW	2	52110324	unclassified	probably benign
R1689:Rif1	UTSW	2	52110324	unclassified	probably benign
R1731:Rif1	UTSW	2	52110324	unclassified	probably benign
R1744:Rif1	UTSW	2	52112392	missense	possibly damaging	0.56
R1746:Rif1	UTSW	2	52110324	unclassified	probably benign
R1748:Rif1	UTSW	2	52110324	unclassified	probably benign
R1831:Rif1	UTSW	2	52078495	nonsense	probably null
R1902:Rif1	UTSW	2	52116673	missense	possibly damaging	0.93
R1964:Rif1	UTSW	2	52098409	missense	probably benign	0.01
R1978:Rif1	UTSW	2	52110324	unclassified	probably benign
R2000:Rif1	UTSW	2	52081298	missense	probably damaging	0.99
R2030:Rif1	UTSW	2	52092346	missense	probably damaging	1.00
R2056:Rif1	UTSW	2	52093576	missense	probably damaging	1.00
R2106:Rif1	UTSW	2	52110324	unclassified	probably benign
R2109:Rif1	UTSW	2	52110324	unclassified	probably benign
R2125:Rif1	UTSW	2	52110324	unclassified	probably benign
R2145:Rif1	UTSW	2	52111400	missense	possibly damaging	0.63
R2152:Rif1	UTSW	2	52110324	unclassified	probably benign
R2153:Rif1	UTSW	2	52110324	unclassified	probably benign
R2213:Rif1	UTSW	2	52110324	unclassified	probably benign
R2327:Rif1	UTSW	2	52110324	unclassified	probably benign
R2512:Rif1	UTSW	2	52110324	unclassified	probably benign
R2513:Rif1	UTSW	2	52110324	unclassified	probably benign
R2516:Rif1	UTSW	2	52110324	unclassified	probably benign
R2520:Rif1	UTSW	2	52110324	unclassified	probably benign
R2905:Rif1	UTSW	2	52098504	missense	probably damaging	0.99
R3005:Rif1	UTSW	2	52082764	missense	probably damaging	1.00
R3155:Rif1	UTSW	2	52110324	unclassified	probably benign
R3156:Rif1	UTSW	2	52110324	unclassified	probably benign
R3429:Rif1	UTSW	2	52110324	unclassified	probably benign
R3707:Rif1	UTSW	2	52093580	missense	probably damaging	1.00
R3907:Rif1	UTSW	2	52112545	missense	probably benign	0.03
R3978:Rif1	UTSW	2	52116747	critical splice donor site	probably null
R4023:Rif1	UTSW	2	52121087	missense	probably benign	0.01
R4052:Rif1	UTSW	2	52098471	nonsense	probably null
R4668:Rif1	UTSW	2	52111952	missense	probably benign	0.01
R4674:Rif1	UTSW	2	52106942	missense	probably null	1.00
R4715:Rif1	UTSW	2	52073139	utr 5 prime	probably benign
R4766:Rif1	UTSW	2	52098934	missense	probably damaging	1.00
R4783:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4785:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4869:Rif1	UTSW	2	52093611	intron	probably benign
R4911:Rif1	UTSW	2	52110518	missense	probably damaging	0.98
R4951:Rif1	UTSW	2	52084986	splice site	probably null
R5044:Rif1	UTSW	2	52109928	missense	probably damaging	0.99
R5088:Rif1	UTSW	2	52092295	missense	possibly damaging	0.91
R5151:Rif1	UTSW	2	52120309	missense	probably damaging	1.00
R5187:Rif1	UTSW	2	52081289	missense	probably damaging	1.00
R5222:Rif1	UTSW	2	52077020	missense	probably benign	0.08
R5243:Rif1	UTSW	2	52111824	missense	possibly damaging	0.86
R5436:Rif1	UTSW	2	52120971	intron	probably benign
R5476:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
R5496:Rif1	UTSW	2	52098916	missense	probably damaging	1.00
R5641:Rif1	UTSW	2	52121158	missense	possibly damaging	0.80
R5883:Rif1	UTSW	2	52105639	critical splice donor site	probably null
R5987:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5990:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5992:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6019:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6020:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6255:Rif1	UTSW	2	52085053	missense	probably damaging	1.00
R6342:Rif1	UTSW	2	52119156	missense	probably damaging	0.97
R6364:Rif1	UTSW	2	52107669	missense	probably damaging	0.97
R6747:Rif1	UTSW	2	52078263	splice site	probably null
R6928:Rif1	UTSW	2	52095961	missense	probably damaging	1.00
R6954:Rif1	UTSW	2	52112691	missense	probably benign	0.00
R7003:Rif1	UTSW	2	52076989	missense	probably benign	0.06
R7310:Rif1	UTSW	2	52105619	missense	probably benign	0.12
R7549:Rif1	UTSW	2	52078507	missense	possibly damaging	0.52
R7603:Rif1	UTSW	2	52076175	missense	probably damaging	1.00
R7673:Rif1	UTSW	2	52088654	missense	probably damaging	1.00
R7741:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R7777:Rif1	UTSW	2	52116356	missense	probably benign	0.00
R7910:Rif1	UTSW	2	52078387	nonsense	probably null
R7962:Rif1	UTSW	2	52074276	missense	probably damaging	1.00
R8264:Rif1	UTSW	2	52090278	missense	noncoding transcript
R8390:Rif1	UTSW	2	52110923	missense	probably damaging	1.00
R8479:Rif1	UTSW	2	52112551	missense	possibly damaging	0.52
R8490:Rif1	UTSW	2	52110999	missense	probably damaging	0.96
R8762:Rif1	UTSW	2	52111730	missense
R8785:Rif1	UTSW	2	52110481	missense	probably benign	0.06
R8890:Rif1	UTSW	2	52098863	missense	probably damaging	0.99
R9081:Rif1	UTSW	2	52110977	missense	probably damaging	0.99
R9225:Rif1	UTSW	2	52111850	missense	probably benign	0.22
R9284:Rif1	UTSW	2	52108552	missense	probably benign	0.00
R9300:Rif1	UTSW	2	52111139	missense	probably damaging	1.00
R9366:Rif1	UTSW	2	52120344	missense
R9477:Rif1	UTSW	2	52111330	missense	probably benign	0.02
R9522:Rif1	UTSW	2	52081299	missense	probably damaging	1.00
R9573:Rif1	UTSW	2	52110454	missense	probably benign	0.29
R9630:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
X0064:Rif1	UTSW	2	52074315	missense	probably benign	0.00
X0064:Rif1	UTSW	2	52094633	missense	probably damaging	0.96
Z1177:Rif1	UTSW	2	52088648	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCGGTGGTCAGCAGTAGTTC -3'
(R):5'- TCTGTTGGGCTGAGCAGATC -3'

Sequencing Primer
(F):5'- GCAGTAGTTCAGTTTCTAATGCCAC -3'
(R):5'- AGCAGATCAGGAGAGTTATTTTCG -3'

Posted On

2014-09-17