Incidental Mutation 'R2126:Or4k52'
ID 229849
Institutional Source Beutler Lab
Gene Symbol Or4k52
Ensembl Gene ENSMUSG00000044560
Gene Name olfactory receptor family 4 subfamily K member 52
Synonyms Olfr1302, GA_x6K02T2Q125-72831562-72832500, MOR248-3
MMRRC Submission 040129-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R2126 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 111610658-111611605 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111610841 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 59 (M59V)
Ref Sequence ENSEMBL: ENSMUSP00000150896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054004] [ENSMUST00000119566] [ENSMUST00000214708] [ENSMUST00000215244]
AlphaFold Q8VGE9
Predicted Effect probably damaging
Transcript: ENSMUST00000054004
AA Change: M62V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061674
Gene: ENSMUSG00000044560
AA Change: M62V

DomainStartEndE-ValueType
Pfam:7tm_4 34 308 2.4e-49 PFAM
Pfam:7tm_1 44 290 8.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119566
AA Change: M59V
Predicted Effect probably damaging
Transcript: ENSMUST00000214708
AA Change: M59V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215244
AA Change: M59V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A G 3: 59,947,066 (GRCm39) T255A possibly damaging Het
Acat3 C T 17: 13,146,294 (GRCm39) A230T probably benign Het
Acsl1 C A 8: 46,986,663 (GRCm39) P650Q probably benign Het
Adgrl3 T A 5: 81,660,383 (GRCm39) I316N probably damaging Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
AI429214 T A 8: 37,461,362 (GRCm39) V170E probably benign Het
Akap13 G A 7: 75,375,052 (GRCm39) G1895S possibly damaging Het
Alpk2 G A 18: 65,483,439 (GRCm39) Q190* probably null Het
Aox3 C A 1: 58,197,375 (GRCm39) Q574K probably benign Het
Apeh A G 9: 107,962,866 (GRCm39) Y702H probably damaging Het
Aqp11 A G 7: 97,386,692 (GRCm39) I151T probably benign Het
Arhgap28 A G 17: 68,176,010 (GRCm39) V363A possibly damaging Het
Arhgef18 A G 8: 3,501,939 (GRCm39) N699S probably damaging Het
Asnsd1 A G 1: 53,386,476 (GRCm39) S384P probably benign Het
Atl1 G T 12: 69,978,431 (GRCm39) probably null Het
Atp13a2 A T 4: 140,722,702 (GRCm39) D203V possibly damaging Het
Axdnd1 A T 1: 156,160,784 (GRCm39) N164K probably benign Het
Bnipl T A 3: 95,152,994 (GRCm39) I162F probably damaging Het
Cacna1d A T 14: 29,845,120 (GRCm39) L655I probably damaging Het
Canx T C 11: 50,195,185 (GRCm39) I294M probably damaging Het
Casz1 T C 4: 149,030,521 (GRCm39) F1180S probably damaging Het
Cav3 T C 6: 112,449,344 (GRCm39) Y121H probably benign Het
Cd4 A C 6: 124,847,499 (GRCm39) S222A probably benign Het
Cds1 T C 5: 101,960,416 (GRCm39) I289T probably benign Het
Cep112 T C 11: 108,399,084 (GRCm39) F328L probably damaging Het
Ces4a G A 8: 105,864,729 (GRCm39) G69S probably damaging Het
Cfap44 A T 16: 44,230,838 (GRCm39) D273V probably benign Het
Cfap91 T C 16: 38,162,124 (GRCm39) T6A probably benign Het
Clec7a C T 6: 129,447,918 (GRCm39) G49D probably benign Het
Col22a1 G A 15: 71,729,102 (GRCm39) Q599* probably null Het
Col6a5 T A 9: 105,822,799 (GRCm39) H186L unknown Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dnah12 A T 14: 26,445,613 (GRCm39) R725* probably null Het
Dnajc10 G A 2: 80,181,078 (GRCm39) probably null Het
Edem3 A T 1: 151,670,482 (GRCm39) H337L possibly damaging Het
Eif2ak4 A T 2: 118,252,604 (GRCm39) H392L probably benign Het
Ercc6l2 G A 13: 63,996,585 (GRCm39) V365I probably damaging Het
Fan1 T C 7: 63,996,636 (GRCm39) E978G probably damaging Het
Fcrl6 C T 1: 172,426,815 (GRCm39) V44M probably benign Het
Gaa G A 11: 119,161,108 (GRCm39) W50* probably null Het
Gm10032 T C 14: 67,030,227 (GRCm39) noncoding transcript Het
Gm10985 CTCTAT CT 3: 53,752,670 (GRCm39) probably null Het
Gprc5b G T 7: 118,583,398 (GRCm39) P157Q probably damaging Het
Gsdmc3 G A 15: 63,730,383 (GRCm39) Q394* probably null Het
Gucd1 A G 10: 75,347,922 (GRCm39) S38P probably damaging Het
Higd1a A T 9: 121,679,313 (GRCm39) I58N probably damaging Het
Hmx3 G C 7: 131,146,278 (GRCm39) V329L possibly damaging Het
Hnrnpul2 A T 19: 8,801,802 (GRCm39) R337* probably null Het
Idua T A 5: 108,829,304 (GRCm39) H368Q possibly damaging Het
Ifih1 A G 2: 62,453,811 (GRCm39) V218A probably benign Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Kif1b G A 4: 149,272,097 (GRCm39) S1568L possibly damaging Het
Klhl30 T A 1: 91,286,499 (GRCm39) probably null Het
Lasp1 T A 11: 97,726,960 (GRCm39) D227E probably benign Het
Lhx6 A G 2: 35,981,336 (GRCm39) I85T possibly damaging Het
Limch1 A G 5: 67,187,103 (GRCm39) D840G probably damaging Het
Loxl4 C G 19: 42,592,402 (GRCm39) E385D probably damaging Het
Lrrtm4 A T 6: 79,998,722 (GRCm39) I44F probably damaging Het
Ltbp2 T C 12: 84,832,483 (GRCm39) probably null Het
Lyg1 T C 1: 37,989,755 (GRCm39) Y44C probably damaging Het
Map1a A G 2: 121,129,122 (GRCm39) I129V probably damaging Het
Med27 C T 2: 29,414,442 (GRCm39) Q150* probably null Het
Ms4a5 A T 19: 11,256,732 (GRCm39) I55N probably damaging Het
Muc5ac T C 7: 141,364,479 (GRCm39) S2597P possibly damaging Het
Mxd1 A C 6: 86,628,422 (GRCm39) probably null Het
Myo3a A G 2: 22,468,186 (GRCm39) D480G probably benign Het
Neb T C 2: 52,200,650 (GRCm39) Y343C probably damaging Het
Niban1 A C 1: 151,571,886 (GRCm39) E277A probably damaging Het
Niban1 A G 1: 151,584,884 (GRCm39) I494V possibly damaging Het
Nrn1 A C 13: 36,914,180 (GRCm39) V34G probably damaging Het
Or4n5 A G 14: 50,132,524 (GRCm39) I245T probably benign Het
Or52b1 C T 7: 104,978,459 (GRCm39) W313* probably null Het
Or56a3 A G 7: 104,735,822 (GRCm39) T300A probably damaging Het
Or8b39 G T 9: 37,996,572 (GRCm39) V147L probably benign Het
Or8h9 T C 2: 86,789,442 (GRCm39) Y120C possibly damaging Het
Or8k40 A T 2: 86,584,796 (GRCm39) N95K probably benign Het
Pdia4 A T 6: 47,773,771 (GRCm39) V526E probably damaging Het
Pdia6 T C 12: 17,328,546 (GRCm39) V167A probably damaging Het
Pgk2 A G 17: 40,518,400 (GRCm39) F343L probably damaging Het
Piwil1 T C 5: 128,831,160 (GRCm39) V827A probably damaging Het
Plag1 A T 4: 3,904,169 (GRCm39) Y341N possibly damaging Het
Plch2 T C 4: 155,083,456 (GRCm39) E393G probably damaging Het
Ptprg T A 14: 12,154,355 (GRCm38) M692K probably benign Het
Rassf8 G A 6: 145,760,908 (GRCm39) R78H probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rnf213 A G 11: 119,341,027 (GRCm39) Q3556R probably damaging Het
Rpa2 T C 4: 132,496,099 (GRCm39) probably null Het
Rpe T G 1: 66,755,139 (GRCm39) F174V possibly damaging Het
Sbf2 T C 7: 110,159,502 (GRCm39) D36G probably damaging Het
Scn2a T A 2: 65,582,423 (GRCm39) Y1590* probably null Het
Slc24a4 T C 12: 102,189,018 (GRCm39) V151A probably damaging Het
Slc30a8 A T 15: 52,159,330 (GRCm39) M17L probably benign Het
Slit3 T C 11: 35,579,506 (GRCm39) Y1228H probably damaging Het
Smad4 G A 18: 73,795,815 (GRCm39) T193M probably benign Het
Smtn T A 11: 3,480,045 (GRCm39) H392L probably benign Het
St8sia3 A G 18: 64,402,745 (GRCm39) D128G probably damaging Het
Sucla2 A T 14: 73,830,108 (GRCm39) M382L possibly damaging Het
Tbx5 A G 5: 119,974,988 (GRCm39) T4A probably benign Het
Tdrd5 T C 1: 156,104,143 (GRCm39) R528G probably damaging Het
Tex44 T C 1: 86,354,811 (GRCm39) L240P probably benign Het
Tns4 A T 11: 98,970,904 (GRCm39) probably null Het
Trappc10 A T 10: 78,039,758 (GRCm39) V731E possibly damaging Het
Ttf1 A G 2: 28,961,357 (GRCm39) K582E probably damaging Het
Ttf2 C A 3: 100,855,509 (GRCm39) Q895H possibly damaging Het
Ttll6 A G 11: 96,038,358 (GRCm39) E402G probably damaging Het
Ttn A T 2: 76,720,436 (GRCm39) probably null Het
Ugt8a T C 3: 125,669,195 (GRCm39) D303G probably damaging Het
Ulk1 G T 5: 110,940,302 (GRCm39) A373D probably benign Het
Vmn2r13 A G 5: 109,306,058 (GRCm39) S507P probably benign Het
Vmn2r19 T A 6: 123,293,033 (GRCm39) D358E possibly damaging Het
Vmn2r88 T C 14: 51,651,264 (GRCm39) S201P probably benign Het
Zfp36l2 A G 17: 84,494,403 (GRCm39) F78S probably damaging Het
Zfp454 A C 11: 50,764,822 (GRCm39) S203R probably benign Het
Zfp616 C A 11: 73,976,229 (GRCm39) Q833K probably benign Het
Znhit2 A G 19: 6,112,091 (GRCm39) T279A probably benign Het
Zswim3 T A 2: 164,661,913 (GRCm39) I131N probably benign Het
Other mutations in Or4k52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Or4k52 APN 2 111,611,246 (GRCm39) missense possibly damaging 0.80
IGL01604:Or4k52 APN 2 111,610,935 (GRCm39) missense possibly damaging 0.60
IGL02959:Or4k52 APN 2 111,610,955 (GRCm39) missense probably damaging 1.00
IGL02975:Or4k52 APN 2 111,611,266 (GRCm39) nonsense probably null
IGL03357:Or4k52 APN 2 111,610,871 (GRCm39) missense probably benign 0.01
R0245:Or4k52 UTSW 2 111,610,680 (GRCm39) missense probably damaging 1.00
R1522:Or4k52 UTSW 2 111,610,693 (GRCm39) splice site probably null
R2432:Or4k52 UTSW 2 111,611,016 (GRCm39) missense probably benign 0.01
R4780:Or4k52 UTSW 2 111,611,190 (GRCm39) missense probably damaging 1.00
R5260:Or4k52 UTSW 2 111,611,526 (GRCm39) missense probably damaging 1.00
R5517:Or4k52 UTSW 2 111,610,804 (GRCm39) missense probably benign
R6273:Or4k52 UTSW 2 111,611,567 (GRCm39) missense probably benign 0.00
R7315:Or4k52 UTSW 2 111,611,004 (GRCm39) missense probably damaging 0.96
R7740:Or4k52 UTSW 2 111,610,793 (GRCm39) missense possibly damaging 0.94
R8742:Or4k52 UTSW 2 111,610,910 (GRCm39) missense probably benign 0.03
R8891:Or4k52 UTSW 2 111,611,186 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTTGTTTCTGAAGACACATGAG -3'
(R):5'- GCCACATAACGGTCATATGCC -3'

Sequencing Primer
(F):5'- GTAAAATGGATGGAGGTAATCACTCC -3'
(R):5'- TAACGGTCATATGCCATTACTACC -3'
Posted On 2014-09-17