Incidental Mutation 'R0158:Fbxw25'
ID22986
Institutional Source Beutler Lab
Gene Symbol Fbxw25
Ensembl Gene ENSMUSG00000094992
Gene NameF-box and WD-40 domain protein 25
SynonymsE330001B16Rik
MMRRC Submission 038438-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0158 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location109645122-109664652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109654652 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000128652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163839]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163839
AA Change: V164A

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128652
Gene: ENSMUSG00000094992
AA Change: V164A

DomainStartEndE-ValueType
FBOX 5 45 5.44e-6 SMART
SCOP:d1gxra_ 119 228 1e-6 SMART
Blast:WD40 137 176 6e-6 BLAST
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 93% (79/85)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T G 1: 26,683,951 H716P probably damaging Het
9530053A07Rik A G 7: 28,155,492 I1848V probably damaging Het
Abcf3 C T 16: 20,552,566 R437C probably damaging Het
Abhd3 A G 18: 10,647,840 Y315H possibly damaging Het
Adam19 C T 11: 46,143,034 P891L probably damaging Het
Ampd1 T A 3: 103,091,730 Y400* probably null Het
Ap1g1 T C 8: 109,855,635 S724P probably benign Het
BC067074 T A 13: 113,369,153 L2272* probably null Het
Bst2 T A 8: 71,537,217 T71S possibly damaging Het
C3 A G 17: 57,224,851 probably null Het
Cacna2d1 C A 5: 16,361,817 probably benign Het
Cacna2d4 C T 6: 119,236,748 H43Y possibly damaging Het
Ccdc71 T G 9: 108,464,137 V383G probably benign Het
Cd109 A T 9: 78,688,932 Q849L possibly damaging Het
Cdkn2a A T 4: 89,276,767 H115Q possibly damaging Het
Ces1e T C 8: 93,219,429 E161G probably benign Het
Cggbp1 C T 16: 64,855,838 S89L possibly damaging Het
Crocc A T 4: 141,042,242 probably benign Het
Eef1akmt3 G A 10: 127,033,273 Q111* probably null Het
Exoc7 T C 11: 116,295,292 N361S probably benign Het
Fat2 G T 11: 55,296,185 S1278R probably benign Het
Fbxo42 A G 4: 141,200,329 N640S probably benign Het
Foxs1 T C 2: 152,932,410 E241G probably damaging Het
Fras1 A T 5: 96,776,634 I3645F possibly damaging Het
Gm14496 T A 2: 181,997,413 V432E probably benign Het
Herc1 T A 9: 66,495,921 L4374* probably null Het
Hist1h3b T A 13: 23,752,710 C111S probably damaging Het
Ift122 T C 6: 115,924,484 probably benign Het
Itgav C A 2: 83,792,037 N654K probably benign Het
Itih5 T C 2: 10,234,992 probably benign Het
Jak2 C A 19: 29,311,757 T1103K probably benign Het
Kcnc4 C A 3: 107,458,604 C96F probably benign Het
Med13l C A 5: 118,742,449 S1202Y unknown Het
Mefv T C 16: 3,715,456 E317G possibly damaging Het
Ncoa2 T C 1: 13,152,384 T1226A probably benign Het
Nktr C T 9: 121,750,691 probably benign Het
Nudt5 G A 2: 5,862,303 V61M probably damaging Het
Olfr33 C T 7: 102,713,955 A153T probably benign Het
Palm2 A G 4: 57,709,649 D198G possibly damaging Het
Papd5 G A 8: 88,250,743 G391D probably damaging Het
Pcdhb2 A C 18: 37,297,230 Y752S probably damaging Het
Pcnx4 A G 12: 72,556,302 D446G probably benign Het
Pnp2 G A 14: 50,964,304 R249H probably damaging Het
Rgs3 A T 4: 62,623,884 I32F probably damaging Het
Rnf139 A G 15: 58,898,878 T251A probably benign Het
Rnf41 A G 10: 128,438,235 E252G probably damaging Het
Rxfp2 T A 5: 150,051,628 F220Y probably benign Het
Sdcbp A G 4: 6,379,042 D43G possibly damaging Het
Serpina3f A G 12: 104,217,008 D43G probably damaging Het
Sftpc T C 14: 70,521,447 K154R probably null Het
Simc1 A G 13: 54,524,717 T293A probably benign Het
Skint6 A T 4: 113,184,814 probably benign Het
Slc6a15 T C 10: 103,389,347 probably benign Het
Ston2 A T 12: 91,740,602 I78N probably damaging Het
Taok3 T C 5: 117,217,242 probably null Het
Tiam1 C T 16: 89,793,001 probably benign Het
Tnfsf15 T C 4: 63,729,992 H137R possibly damaging Het
Tpte G A 8: 22,327,739 R247H possibly damaging Het
Trim2 T C 3: 84,210,169 probably benign Het
Ulk1 A T 5: 110,788,944 probably benign Het
Utp4 T G 8: 106,913,386 H442Q probably null Het
Vmn1r193 T A 13: 22,219,628 I65F probably damaging Het
Vps54 A T 11: 21,306,962 Q690L probably damaging Het
Ybx2 T C 11: 69,940,319 probably benign Het
Zbtb38 C T 9: 96,686,940 G697D possibly damaging Het
Zfp202 C T 9: 40,208,916 Q218* probably null Het
Zfp820 G A 17: 21,819,819 T176I probably benign Het
Other mutations in Fbxw25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03330:Fbxw25 APN 9 109645239 missense probably benign 0.00
R0850:Fbxw25 UTSW 9 109649617 missense probably benign
R1109:Fbxw25 UTSW 9 109650060 missense probably benign 0.00
R1386:Fbxw25 UTSW 9 109654641 missense possibly damaging 0.77
R1609:Fbxw25 UTSW 9 109663510 missense probably benign 0.11
R1750:Fbxw25 UTSW 9 109650073 missense probably benign 0.23
R1977:Fbxw25 UTSW 9 109652856 missense possibly damaging 0.72
R2427:Fbxw25 UTSW 9 109652860 missense probably benign 0.09
R3841:Fbxw25 UTSW 9 109662134 nonsense probably null
R4356:Fbxw25 UTSW 9 109662085 missense probably damaging 1.00
R4934:Fbxw25 UTSW 9 109651637 missense possibly damaging 0.63
R5024:Fbxw25 UTSW 9 109663374 critical splice donor site probably null
R5175:Fbxw25 UTSW 9 109664563 missense probably damaging 1.00
R5323:Fbxw25 UTSW 9 109663505 missense probably benign 0.04
R5389:Fbxw25 UTSW 9 109652886 missense possibly damaging 0.95
R5493:Fbxw25 UTSW 9 109652916 missense probably benign 0.01
R6268:Fbxw25 UTSW 9 109654650 missense probably damaging 1.00
R6739:Fbxw25 UTSW 9 109651631 missense probably benign 0.29
R7275:Fbxw25 UTSW 9 109654592 missense
R7492:Fbxw25 UTSW 9 109664530 critical splice donor site probably null
R7623:Fbxw25 UTSW 9 109654583 missense
R7784:Fbxw25 UTSW 9 109650119 missense
X0023:Fbxw25 UTSW 9 109651775 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCTTTTGAAGAGACTCCAAGATGGC -3'
(R):5'- GGACAAGGCTTCCAAATAAAGCTGGTG -3'

Sequencing Primer
(F):5'- GACTCCAAGATGGCAAGTTAAG -3'
(R):5'- CTGGTGGGTGAAAGCAGC -3'
Posted On2013-04-16