Mutagenetix > Incidental Mutation

Incidental Mutation 'R2126:Casz1'

229864

Institutional Source

Beutler Lab

Gene Symbol

Casz1

Ensembl Gene

ENSMUSG00000028977

Gene Name

castor zinc finger 1

Synonyms

D4Ertd432e, 2410019P08Rik, Cst, castor

MMRRC Submission

040129-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2126 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

148804429-148954889 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 148946064 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1180 (F1180S)

Ref Sequence

ENSEMBL: ENSMUSP00000112978 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000094464

SMART Domains

Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977

Domain	Start	End	E-Value	Type
low complexity region	403	420	N/A	INTRINSIC
ZnF_C2H2	489	514	5.34e0	SMART
ZnF_C2H2	550	574	8.09e-1	SMART
ZnF_C2H2	609	633	9.3e-1	SMART
low complexity region	643	658	N/A	INTRINSIC
ZnF_C2H2	667	691	1.1e-2	SMART
low complexity region	698	711	N/A	INTRINSIC
low complexity region	728	766	N/A	INTRINSIC
low complexity region	796	807	N/A	INTRINSIC
low complexity region	810	834	N/A	INTRINSIC
low complexity region	875	890	N/A	INTRINSIC
low complexity region	951	957	N/A	INTRINSIC
ZnF_C2H2	1031	1055	2.29e1	SMART
low complexity region	1080	1091	N/A	INTRINSIC
low complexity region	1105	1115	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000122222
AA Change: F1180S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: F1180S

Domain	Start	End	E-Value	Type
low complexity region	403	420	N/A	INTRINSIC
ZnF_C2H2	489	514	5.34e0	SMART
ZnF_C2H2	550	574	8.09e-1	SMART
ZnF_C2H2	609	633	9.3e-1	SMART
low complexity region	643	658	N/A	INTRINSIC
ZnF_C2H2	667	691	1.1e-2	SMART
low complexity region	698	711	N/A	INTRINSIC
low complexity region	728	766	N/A	INTRINSIC
low complexity region	796	807	N/A	INTRINSIC
low complexity region	810	834	N/A	INTRINSIC
low complexity region	875	890	N/A	INTRINSIC
low complexity region	951	957	N/A	INTRINSIC
ZnF_C2H2	1031	1055	2.29e1	SMART
low complexity region	1080	1091	N/A	INTRINSIC
low complexity region	1105	1115	N/A	INTRINSIC
ZnF_C2H2	1182	1206	1.59e1	SMART
ZnF_C2H2	1242	1266	2.47e1	SMART
ZnF_C2H2	1300	1324	3.47e0	SMART
ZnF_C2H2	1457	1481	7.89e0	SMART
ZnF_C2H2	1515	1537	3.21e1	SMART
ZnF_C2H2	1571	1595	3.99e0	SMART
low complexity region	1632	1649	N/A	INTRINSIC
SCOP:d1qbkb_	1675	1742	2e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123548

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadac	A	G	3: 60,039,645	T255A	possibly damaging	Het
Acat3	C	T	17: 12,927,407	A230T	probably benign	Het
Acsl1	C	A	8: 46,533,626	P650Q	probably benign	Het
Adgrl3	T	A	5: 81,512,536	I316N	probably damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
AI429214	T	A	8: 36,994,208	V170E	probably benign	Het
Akap13	G	A	7: 75,725,304	G1895S	possibly damaging	Het
Alpk2	G	A	18: 65,350,368	Q190*	probably null	Het
Aox3	C	A	1: 58,158,216	Q574K	probably benign	Het
Apeh	A	G	9: 108,085,667	Y702H	probably damaging	Het
Aqp11	A	G	7: 97,737,485	I151T	probably benign	Het
Arhgap28	A	G	17: 67,869,015	V363A	possibly damaging	Het
Arhgef18	A	G	8: 3,451,939	N699S	probably damaging	Het
Asnsd1	A	G	1: 53,347,317	S384P	probably benign	Het
Atl1	G	T	12: 69,931,657		probably null	Het
Atp13a2	A	T	4: 140,995,391	D203V	possibly damaging	Het
Axdnd1	A	T	1: 156,333,214	N164K	probably benign	Het
Bnipl	T	A	3: 95,245,683	I162F	probably damaging	Het
Cacna1d	A	T	14: 30,123,163	L655I	probably damaging	Het
Canx	T	C	11: 50,304,358	I294M	probably damaging	Het
Cav3	T	C	6: 112,472,383	Y121H	probably benign	Het
Cd4	A	C	6: 124,870,536	S222A	probably benign	Het
Cds1	T	C	5: 101,812,550	I289T	probably benign	Het
Cep112	T	C	11: 108,508,258	F328L	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap44	A	T	16: 44,410,475	D273V	probably benign	Het
Clec7a	C	T	6: 129,470,955	G49D	probably benign	Het
Col22a1	G	A	15: 71,857,253	Q599*	probably null	Het
Col6a5	T	A	9: 105,945,600	H186L	unknown	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnah12	A	T	14: 26,724,458	R725*	probably null	Het
Dnajc10	G	A	2: 80,350,734		probably null	Het
Edem3	A	T	1: 151,794,731	H337L	possibly damaging	Het
Eif2ak4	A	T	2: 118,422,123	H392L	probably benign	Het
Ercc6l2	G	A	13: 63,848,771	V365I	probably damaging	Het
Fam129a	A	C	1: 151,696,135	E277A	probably damaging	Het
Fam129a	A	G	1: 151,709,133	I494V	possibly damaging	Het
Fan1	T	C	7: 64,346,888	E978G	probably damaging	Het
Fcrl6	C	T	1: 172,599,248	V44M	probably benign	Het
Gaa	G	A	11: 119,270,282	W50*	probably null	Het
Gm10032	T	C	14: 66,792,778		noncoding transcript	Het
Gm10985	CTCTAT	CT	3: 53,845,249		probably null	Het
Gprc5b	G	T	7: 118,984,175	P157Q	probably damaging	Het
Gsdmc3	G	A	15: 63,858,534	Q394*	probably null	Het
Gucd1	A	G	10: 75,512,088	S38P	probably damaging	Het
Higd1a	A	T	9: 121,850,247	I58N	probably damaging	Het
Hmx3	G	C	7: 131,544,549	V329L	possibly damaging	Het
Hnrnpul2	A	T	19: 8,824,438	R337*	probably null	Het
Idua	T	A	5: 108,681,438	H368Q	possibly damaging	Het
Ifih1	A	G	2: 62,623,467	V218A	probably benign	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Klhl30	T	A	1: 91,358,777		probably null	Het
Lasp1	T	A	11: 97,836,134	D227E	probably benign	Het
Lhx6	A	G	2: 36,091,324	I85T	possibly damaging	Het
Limch1	A	G	5: 67,029,760	D840G	probably damaging	Het
Loxl4	C	G	19: 42,603,963	E385D	probably damaging	Het
Lrrtm4	A	T	6: 80,021,739	I44F	probably damaging	Het
Ltbp2	T	C	12: 84,785,709		probably null	Het
Lyg1	T	C	1: 37,950,674	Y44C	probably damaging	Het
Maats1	T	C	16: 38,341,762	T6A	probably benign	Het
Map1a	A	G	2: 121,298,641	I129V	probably damaging	Het
Med27	C	T	2: 29,524,430	Q150*	probably null	Het
Ms4a5	A	T	19: 11,279,368	I55N	probably damaging	Het
Muc5ac	T	C	7: 141,810,742	S2597P	possibly damaging	Het
Mxd1	A	C	6: 86,651,440		probably null	Het
Myo3a	A	G	2: 22,578,174	D480G	probably benign	Het
Neb	T	C	2: 52,310,638	Y343C	probably damaging	Het
Nrn1	A	C	13: 36,730,206	V34G	probably damaging	Het
Olfr1090	A	T	2: 86,754,452	N95K	probably benign	Het
Olfr1099	T	C	2: 86,959,098	Y120C	possibly damaging	Het
Olfr1302	A	G	2: 111,780,496	M59V	probably damaging	Het
Olfr679	A	G	7: 105,086,615	T300A	probably damaging	Het
Olfr690	C	T	7: 105,329,252	W313*	probably null	Het
Olfr722	A	G	14: 49,895,067	I245T	probably benign	Het
Olfr887	G	T	9: 38,085,276	V147L	probably benign	Het
Pdia4	A	T	6: 47,796,837	V526E	probably damaging	Het
Pdia6	T	C	12: 17,278,545	V167A	probably damaging	Het
Pgk2	A	G	17: 40,207,509	F343L	probably damaging	Het
Piwil1	T	C	5: 128,754,096	V827A	probably damaging	Het
Plag1	A	T	4: 3,904,169	Y341N	possibly damaging	Het
Plch2	T	C	4: 154,998,999	E393G	probably damaging	Het
Ptprg	T	A	14: 12,154,355	M692K	probably benign	Het
Rassf8	G	A	6: 145,815,182	R78H	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf213	A	G	11: 119,450,201	Q3556R	probably damaging	Het
Rpa2	T	C	4: 132,768,788		probably null	Het
Rpe	T	G	1: 66,715,980	F174V	possibly damaging	Het
Sbf2	T	C	7: 110,560,295	D36G	probably damaging	Het
Scn2a	T	A	2: 65,752,079	Y1590*	probably null	Het
Slc24a4	T	C	12: 102,222,759	V151A	probably damaging	Het
Slc30a8	A	T	15: 52,295,934	M17L	probably benign	Het
Slit3	T	C	11: 35,688,679	Y1228H	probably damaging	Het
Smad4	G	A	18: 73,662,744	T193M	probably benign	Het
Smtn	T	A	11: 3,530,045	H392L	probably benign	Het
St8sia3	A	G	18: 64,269,674	D128G	probably damaging	Het
Sucla2	A	T	14: 73,592,668	M382L	possibly damaging	Het
Tbx5	A	G	5: 119,836,923	T4A	probably benign	Het
Tdrd5	T	C	1: 156,276,573	R528G	probably damaging	Het
Tex44	T	C	1: 86,427,089	L240P	probably benign	Het
Tns4	A	T	11: 99,080,078		probably null	Het
Trappc10	A	T	10: 78,203,924	V731E	possibly damaging	Het
Ttf1	A	G	2: 29,071,345	K582E	probably damaging	Het
Ttf2	C	A	3: 100,948,193	Q895H	possibly damaging	Het
Ttll6	A	G	11: 96,147,532	E402G	probably damaging	Het
Ttn	A	T	2: 76,890,092		probably null	Het
Ugt8a	T	C	3: 125,875,546	D303G	probably damaging	Het
Ulk1	G	T	5: 110,792,436	A373D	probably benign	Het
Vmn2r13	A	G	5: 109,158,192	S507P	probably benign	Het
Vmn2r19	T	A	6: 123,316,074	D358E	possibly damaging	Het
Vmn2r88	T	C	14: 51,413,807	S201P	probably benign	Het
Zfp36l2	A	G	17: 84,186,975	F78S	probably damaging	Het
Zfp454	A	C	11: 50,873,995	S203R	probably benign	Het
Zfp616	C	A	11: 74,085,403	Q833K	probably benign	Het
Znhit2	A	G	19: 6,062,061	T279A	probably benign	Het
Zswim3	T	A	2: 164,819,993	I131N	probably benign	Het

Other mutations in Casz1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00914:Casz1	APN	4	148929371	missense	probably damaging	1.00
IGL02137:Casz1	APN	4	148933468	missense	possibly damaging	0.71
IGL02176:Casz1	APN	4	148934619	missense	probably damaging	1.00
IGL02629:Casz1	APN	4	148944391	missense	probably benign	0.01
IGL02871:Casz1	APN	4	148944319	missense	possibly damaging	0.93
FR4340:Casz1	UTSW	4	148952302	small deletion	probably benign
G1Funyon:Casz1	UTSW	4	148946043	missense	probably damaging	0.98
H8562:Casz1	UTSW	4	148933451	missense	probably damaging	1.00
R0090:Casz1	UTSW	4	148933411	missense	probably benign	0.00
R0389:Casz1	UTSW	4	148948911	missense	possibly damaging	0.83
R0443:Casz1	UTSW	4	148948911	missense	possibly damaging	0.83
R0550:Casz1	UTSW	4	148952284	small deletion	probably benign
R0597:Casz1	UTSW	4	148944394	missense	probably benign	0.00
R1117:Casz1	UTSW	4	148934595	missense	probably damaging	1.00
R1476:Casz1	UTSW	4	148946171	missense	probably benign	0.05
R1540:Casz1	UTSW	4	148942900	unclassified	probably benign
R1610:Casz1	UTSW	4	148929087	missense	possibly damaging	0.54
R1764:Casz1	UTSW	4	148942900	unclassified	probably benign
R1779:Casz1	UTSW	4	148932937	missense	probably benign	0.00
R1874:Casz1	UTSW	4	148943211	missense	probably damaging	0.99
R1902:Casz1	UTSW	4	148936195	missense	possibly damaging	0.95
R1914:Casz1	UTSW	4	148932958	missense	probably damaging	1.00
R2261:Casz1	UTSW	4	148929099	missense	probably damaging	0.96
R2262:Casz1	UTSW	4	148929099	missense	probably damaging	0.96
R3874:Casz1	UTSW	4	148939589	intron	probably benign
R4019:Casz1	UTSW	4	148932878	missense	probably benign	0.00
R4355:Casz1	UTSW	4	148952335	missense	unknown
R4420:Casz1	UTSW	4	148948918	missense	possibly damaging	0.90
R4610:Casz1	UTSW	4	148933267	missense	probably damaging	1.00
R4632:Casz1	UTSW	4	148951855	missense	possibly damaging	0.71
R4762:Casz1	UTSW	4	148938981	missense	probably damaging	1.00
R4824:Casz1	UTSW	4	148944571	missense	probably damaging	1.00
R4907:Casz1	UTSW	4	148944541	missense	probably damaging	1.00
R5628:Casz1	UTSW	4	148946096	missense	probably damaging	1.00
R5736:Casz1	UTSW	4	148929410	missense	probably benign	0.00
R5929:Casz1	UTSW	4	148938696	missense	probably damaging	1.00
R5929:Casz1	UTSW	4	148938969	missense	probably damaging	1.00
R5932:Casz1	UTSW	4	148939113	missense	possibly damaging	0.52
R6016:Casz1	UTSW	4	148934584	missense	probably damaging	1.00
R6019:Casz1	UTSW	4	148947038	missense	probably damaging	0.99
R6139:Casz1	UTSW	4	148951697	missense	probably damaging	1.00
R6223:Casz1	UTSW	4	148933383	missense	probably damaging	1.00
R6239:Casz1	UTSW	4	148938277	missense	probably damaging	1.00
R6323:Casz1	UTSW	4	148941704	missense	possibly damaging	0.89
R6354:Casz1	UTSW	4	148952542	missense	unknown
R6454:Casz1	UTSW	4	148951495	missense	probably damaging	0.99
R6479:Casz1	UTSW	4	148937078	missense	probably damaging	1.00
R6529:Casz1	UTSW	4	148938189	missense	probably damaging	1.00
R6772:Casz1	UTSW	4	148943206	missense	probably damaging	1.00
R7000:Casz1	UTSW	4	148929236	missense	probably damaging	1.00
R7152:Casz1	UTSW	4	148901291	start gained	probably benign
R7324:Casz1	UTSW	4	148947033	missense	probably damaging	0.99
R7339:Casz1	UTSW	4	148951745	missense	probably damaging	1.00
R7388:Casz1	UTSW	4	148952393	missense	unknown
R7480:Casz1	UTSW	4	148944586	missense	probably damaging	0.99
R7719:Casz1	UTSW	4	148944524	missense	probably damaging	0.99
R7789:Casz1	UTSW	4	148929406	missense	probably benign
R7801:Casz1	UTSW	4	148938249	missense	probably damaging	0.99
R7815:Casz1	UTSW	4	148929305	missense	possibly damaging	0.89
R7818:Casz1	UTSW	4	148946076	missense	probably damaging	1.00
R7938:Casz1	UTSW	4	148944486	missense	probably benign	0.05
R8045:Casz1	UTSW	4	148932779	missense	probably damaging	1.00
R8134:Casz1	UTSW	4	148943035	missense	probably damaging	1.00
R8165:Casz1	UTSW	4	148944431	missense	probably damaging	1.00
R8301:Casz1	UTSW	4	148946043	missense	probably damaging	0.98
R8419:Casz1	UTSW	4	148948583	missense	probably benign	0.29
R9047:Casz1	UTSW	4	148939040	missense	probably damaging	1.00
R9420:Casz1	UTSW	4	148938863	missense	probably damaging	0.99
R9584:Casz1	UTSW	4	148901247	start gained	probably benign
RF001:Casz1	UTSW	4	148952304	small deletion	probably benign
RF063:Casz1	UTSW	4	148952304	small deletion	probably benign
X0018:Casz1	UTSW	4	148939008	missense	probably damaging	1.00
X0064:Casz1	UTSW	4	148932952	missense	probably damaging	0.99
Z1088:Casz1	UTSW	4	148944359	missense	probably benign
Z1176:Casz1	UTSW	4	148944359	missense	probably benign
Z1177:Casz1	UTSW	4	148933306	missense	probably damaging	1.00
Z1177:Casz1	UTSW	4	148944359	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTCTAGCTGAATGTTCCCGTTGAG -3'
(R):5'- TCTCTGCCAGGAGAAGCTTG -3'

Sequencing Primer
(F):5'- AATGTTCCCGTTGAGCAGGAG -3'
(R):5'- AGGAGAAGCTTGCCCTGG -3'

Posted On

2014-09-17