Mutagenetix > Incidental Mutation

Incidental Mutation 'R2126:Akap13'

229892

Institutional Source

Beutler Lab

Gene Symbol

Akap13

Ensembl Gene

ENSMUSG00000066406

Gene Name

A kinase (PRKA) anchor protein 13

Synonyms

AKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik

MMRRC Submission

040129-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2126 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75455534-75754609 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 75725304 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 1895 (G1895S)

Ref Sequence

ENSEMBL: ENSMUSP00000147237 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207239] [ENSMUST00000207750]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147005
AA Change: G1895S

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: G1895S

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
internal_repeat_1	485	695	4.85e-5	PROSPERO
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
Pfam:RII_binding_1	1218	1235	4.3e-6	PFAM
low complexity region	1429	1444	N/A	INTRINSIC
low complexity region	1479	1501	N/A	INTRINSIC
low complexity region	1601	1612	N/A	INTRINSIC
low complexity region	1738	1768	N/A	INTRINSIC
C1	1773	1819	1.95e-4	SMART
low complexity region	1876	1887	N/A	INTRINSIC
RhoGEF	1979	2171	1.28e-61	SMART
PH	2213	2316	2.94e-11	SMART
coiled coil region	2326	2363	N/A	INTRINSIC
low complexity region	2411	2430	N/A	INTRINSIC
low complexity region	2462	2472	N/A	INTRINSIC
coiled coil region	2551	2664	N/A	INTRINSIC
low complexity region	2746	2752	N/A	INTRINSIC
low complexity region	2758	2771	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166315
AA Change: G1877S

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: G1877S

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
low complexity region	1433	1448	N/A	INTRINSIC
low complexity region	1483	1505	N/A	INTRINSIC
low complexity region	1583	1594	N/A	INTRINSIC
low complexity region	1720	1750	N/A	INTRINSIC
C1	1755	1801	1.95e-4	SMART
low complexity region	1858	1869	N/A	INTRINSIC
RhoGEF	1961	2153	1.28e-61	SMART
PH	2195	2298	2.94e-11	SMART
coiled coil region	2308	2345	N/A	INTRINSIC
low complexity region	2393	2412	N/A	INTRINSIC
low complexity region	2444	2454	N/A	INTRINSIC
coiled coil region	2533	2646	N/A	INTRINSIC
low complexity region	2728	2734	N/A	INTRINSIC
low complexity region	2740	2753	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207239
AA Change: G176S

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207750
AA Change: G1895S

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadac	A	G	3: 60,039,645	T255A	possibly damaging	Het
Acat3	C	T	17: 12,927,407	A230T	probably benign	Het
Acsl1	C	A	8: 46,533,626	P650Q	probably benign	Het
Adgrl3	T	A	5: 81,512,536	I316N	probably damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
AI429214	T	A	8: 36,994,208	V170E	probably benign	Het
Alpk2	G	A	18: 65,350,368	Q190*	probably null	Het
Aox3	C	A	1: 58,158,216	Q574K	probably benign	Het
Apeh	A	G	9: 108,085,667	Y702H	probably damaging	Het
Aqp11	A	G	7: 97,737,485	I151T	probably benign	Het
Arhgap28	A	G	17: 67,869,015	V363A	possibly damaging	Het
Arhgef18	A	G	8: 3,451,939	N699S	probably damaging	Het
Asnsd1	A	G	1: 53,347,317	S384P	probably benign	Het
Atl1	G	T	12: 69,931,657		probably null	Het
Atp13a2	A	T	4: 140,995,391	D203V	possibly damaging	Het
Axdnd1	A	T	1: 156,333,214	N164K	probably benign	Het
Bnipl	T	A	3: 95,245,683	I162F	probably damaging	Het
Cacna1d	A	T	14: 30,123,163	L655I	probably damaging	Het
Canx	T	C	11: 50,304,358	I294M	probably damaging	Het
Casz1	T	C	4: 148,946,064	F1180S	probably damaging	Het
Cav3	T	C	6: 112,472,383	Y121H	probably benign	Het
Cd4	A	C	6: 124,870,536	S222A	probably benign	Het
Cds1	T	C	5: 101,812,550	I289T	probably benign	Het
Cep112	T	C	11: 108,508,258	F328L	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap44	A	T	16: 44,410,475	D273V	probably benign	Het
Clec7a	C	T	6: 129,470,955	G49D	probably benign	Het
Col22a1	G	A	15: 71,857,253	Q599*	probably null	Het
Col6a5	T	A	9: 105,945,600	H186L	unknown	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnah12	A	T	14: 26,724,458	R725*	probably null	Het
Dnajc10	G	A	2: 80,350,734		probably null	Het
Edem3	A	T	1: 151,794,731	H337L	possibly damaging	Het
Eif2ak4	A	T	2: 118,422,123	H392L	probably benign	Het
Ercc6l2	G	A	13: 63,848,771	V365I	probably damaging	Het
Fam129a	A	C	1: 151,696,135	E277A	probably damaging	Het
Fam129a	A	G	1: 151,709,133	I494V	possibly damaging	Het
Fan1	T	C	7: 64,346,888	E978G	probably damaging	Het
Fcrl6	C	T	1: 172,599,248	V44M	probably benign	Het
Gaa	G	A	11: 119,270,282	W50*	probably null	Het
Gm10032	T	C	14: 66,792,778		noncoding transcript	Het
Gm10985	CTCTAT	CT	3: 53,845,249		probably null	Het
Gprc5b	G	T	7: 118,984,175	P157Q	probably damaging	Het
Gsdmc3	G	A	15: 63,858,534	Q394*	probably null	Het
Gucd1	A	G	10: 75,512,088	S38P	probably damaging	Het
Higd1a	A	T	9: 121,850,247	I58N	probably damaging	Het
Hmx3	G	C	7: 131,544,549	V329L	possibly damaging	Het
Hnrnpul2	A	T	19: 8,824,438	R337*	probably null	Het
Idua	T	A	5: 108,681,438	H368Q	possibly damaging	Het
Ifih1	A	G	2: 62,623,467	V218A	probably benign	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Klhl30	T	A	1: 91,358,777		probably null	Het
Lasp1	T	A	11: 97,836,134	D227E	probably benign	Het
Lhx6	A	G	2: 36,091,324	I85T	possibly damaging	Het
Limch1	A	G	5: 67,029,760	D840G	probably damaging	Het
Loxl4	C	G	19: 42,603,963	E385D	probably damaging	Het
Lrrtm4	A	T	6: 80,021,739	I44F	probably damaging	Het
Ltbp2	T	C	12: 84,785,709		probably null	Het
Lyg1	T	C	1: 37,950,674	Y44C	probably damaging	Het
Maats1	T	C	16: 38,341,762	T6A	probably benign	Het
Map1a	A	G	2: 121,298,641	I129V	probably damaging	Het
Med27	C	T	2: 29,524,430	Q150*	probably null	Het
Ms4a5	A	T	19: 11,279,368	I55N	probably damaging	Het
Muc5ac	T	C	7: 141,810,742	S2597P	possibly damaging	Het
Mxd1	A	C	6: 86,651,440		probably null	Het
Myo3a	A	G	2: 22,578,174	D480G	probably benign	Het
Neb	T	C	2: 52,310,638	Y343C	probably damaging	Het
Nrn1	A	C	13: 36,730,206	V34G	probably damaging	Het
Olfr1090	A	T	2: 86,754,452	N95K	probably benign	Het
Olfr1099	T	C	2: 86,959,098	Y120C	possibly damaging	Het
Olfr1302	A	G	2: 111,780,496	M59V	probably damaging	Het
Olfr679	A	G	7: 105,086,615	T300A	probably damaging	Het
Olfr690	C	T	7: 105,329,252	W313*	probably null	Het
Olfr722	A	G	14: 49,895,067	I245T	probably benign	Het
Olfr887	G	T	9: 38,085,276	V147L	probably benign	Het
Pdia4	A	T	6: 47,796,837	V526E	probably damaging	Het
Pdia6	T	C	12: 17,278,545	V167A	probably damaging	Het
Pgk2	A	G	17: 40,207,509	F343L	probably damaging	Het
Piwil1	T	C	5: 128,754,096	V827A	probably damaging	Het
Plag1	A	T	4: 3,904,169	Y341N	possibly damaging	Het
Plch2	T	C	4: 154,998,999	E393G	probably damaging	Het
Ptprg	T	A	14: 12,154,355	M692K	probably benign	Het
Rassf8	G	A	6: 145,815,182	R78H	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf213	A	G	11: 119,450,201	Q3556R	probably damaging	Het
Rpa2	T	C	4: 132,768,788		probably null	Het
Rpe	T	G	1: 66,715,980	F174V	possibly damaging	Het
Sbf2	T	C	7: 110,560,295	D36G	probably damaging	Het
Scn2a	T	A	2: 65,752,079	Y1590*	probably null	Het
Slc24a4	T	C	12: 102,222,759	V151A	probably damaging	Het
Slc30a8	A	T	15: 52,295,934	M17L	probably benign	Het
Slit3	T	C	11: 35,688,679	Y1228H	probably damaging	Het
Smad4	G	A	18: 73,662,744	T193M	probably benign	Het
Smtn	T	A	11: 3,530,045	H392L	probably benign	Het
St8sia3	A	G	18: 64,269,674	D128G	probably damaging	Het
Sucla2	A	T	14: 73,592,668	M382L	possibly damaging	Het
Tbx5	A	G	5: 119,836,923	T4A	probably benign	Het
Tdrd5	T	C	1: 156,276,573	R528G	probably damaging	Het
Tex44	T	C	1: 86,427,089	L240P	probably benign	Het
Tns4	A	T	11: 99,080,078		probably null	Het
Trappc10	A	T	10: 78,203,924	V731E	possibly damaging	Het
Ttf1	A	G	2: 29,071,345	K582E	probably damaging	Het
Ttf2	C	A	3: 100,948,193	Q895H	possibly damaging	Het
Ttll6	A	G	11: 96,147,532	E402G	probably damaging	Het
Ttn	A	T	2: 76,890,092		probably null	Het
Ugt8a	T	C	3: 125,875,546	D303G	probably damaging	Het
Ulk1	G	T	5: 110,792,436	A373D	probably benign	Het
Vmn2r13	A	G	5: 109,158,192	S507P	probably benign	Het
Vmn2r19	T	A	6: 123,316,074	D358E	possibly damaging	Het
Vmn2r88	T	C	14: 51,413,807	S201P	probably benign	Het
Zfp36l2	A	G	17: 84,186,975	F78S	probably damaging	Het
Zfp454	A	C	11: 50,873,995	S203R	probably benign	Het
Zfp616	C	A	11: 74,085,403	Q833K	probably benign	Het
Znhit2	A	G	19: 6,062,061	T279A	probably benign	Het
Zswim3	T	A	2: 164,819,993	I131N	probably benign	Het

Other mutations in Akap13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Akap13	APN	7	75725971	missense	probably damaging	0.99
IGL00332:Akap13	APN	7	75728919	missense	probably damaging	1.00
IGL00481:Akap13	APN	7	75723895	missense	probably damaging	1.00
IGL00590:Akap13	APN	7	75610669	missense	probably benign	0.01
IGL00655:Akap13	APN	7	75704398	missense	probably damaging	0.99
IGL00766:Akap13	APN	7	75704512	missense	probably damaging	0.96
IGL00818:Akap13	APN	7	75609727	missense	probably benign	0.00
IGL00826:Akap13	APN	7	75677447	missense	probably damaging	1.00
IGL01014:Akap13	APN	7	75750633	utr 3 prime	probably benign
IGL01090:Akap13	APN	7	75666531	missense	probably benign	0.44
IGL01155:Akap13	APN	7	75569936	missense	probably damaging	1.00
IGL01326:Akap13	APN	7	75725348	missense	probably benign	0.30
IGL01456:Akap13	APN	7	75602847	missense	probably damaging	0.98
IGL01460:Akap13	APN	7	75747846	missense	probably benign	0.29
IGL01568:Akap13	APN	7	75608522	nonsense	probably null	0.00
IGL01610:Akap13	APN	7	75720180	missense	possibly damaging	0.71
IGL01610:Akap13	APN	7	75747605	missense	probably damaging	1.00
IGL01615:Akap13	APN	7	75697393	missense	probably damaging	1.00
IGL01667:Akap13	APN	7	75570019	missense	probably damaging	1.00
IGL01705:Akap13	APN	7	75746767	missense	possibly damaging	0.86
IGL02070:Akap13	APN	7	75666545	missense	probably benign	0.27
IGL02269:Akap13	APN	7	75602911	missense	probably benign
IGL02421:Akap13	APN	7	75717806	missense	possibly damaging	0.66
IGL02870:Akap13	APN	7	75609188	missense	probably damaging	0.96
IGL02944:Akap13	APN	7	75608657	missense	probably benign
IGL03051:Akap13	APN	7	75610485	nonsense	probably null
IGL03160:Akap13	APN	7	75730417	missense	probably damaging	1.00
IGL03245:Akap13	APN	7	75609752	missense	probably damaging	0.99
R0254:Akap13	UTSW	7	75736604	splice site	probably benign
R0310:Akap13	UTSW	7	75614930	missense	probably damaging	0.99
R0373:Akap13	UTSW	7	75609929	missense	probably benign	0.00
R0373:Akap13	UTSW	7	75730500	missense	probably damaging	1.00
R0408:Akap13	UTSW	7	75746796	missense	probably damaging	1.00
R0631:Akap13	UTSW	7	75614996	missense	probably damaging	0.99
R0646:Akap13	UTSW	7	75747746	missense	probably damaging	1.00
R0781:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R0845:Akap13	UTSW	7	75725380	missense	probably damaging	1.00
R1004:Akap13	UTSW	7	75687286	missense	probably damaging	0.99
R1024:Akap13	UTSW	7	75677409	missense	probably damaging	1.00
R1110:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R1346:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1349:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1372:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1387:Akap13	UTSW	7	75586193	missense	probably damaging	0.97
R1442:Akap13	UTSW	7	75735778	missense	probably damaging	0.99
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1584:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1696:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1738:Akap13	UTSW	7	75677194	missense	probably damaging	1.00
R1773:Akap13	UTSW	7	75683451	missense	possibly damaging	0.80
R1785:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1786:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1791:Akap13	UTSW	7	75611035	missense	probably benign	0.00
R1819:Akap13	UTSW	7	75608705	missense	probably benign	0.04
R1879:Akap13	UTSW	7	75610727	missense	probably benign	0.01
R1989:Akap13	UTSW	7	75704516	missense	probably benign	0.01
R2016:Akap13	UTSW	7	75704531	missense	probably damaging	0.99
R2092:Akap13	UTSW	7	75610570	missense	probably benign	0.05
R2131:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2132:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2133:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2251:Akap13	UTSW	7	75739477	missense	possibly damaging	0.50
R3704:Akap13	UTSW	7	75666550	missense	probably damaging	1.00
R3713:Akap13	UTSW	7	75586181	missense	probably damaging	0.98
R3731:Akap13	UTSW	7	75611377	missense	probably benign	0.39
R3765:Akap13	UTSW	7	75608837	missense	probably benign	0.04
R3788:Akap13	UTSW	7	75702153	critical splice donor site	probably null
R3793:Akap13	UTSW	7	75610141	missense	probably benign	0.00
R3970:Akap13	UTSW	7	75569951	nonsense	probably null
R4205:Akap13	UTSW	7	75610919	missense	probably benign	0.05
R4257:Akap13	UTSW	7	75611285	missense	probably damaging	0.98
R4374:Akap13	UTSW	7	75608984	missense	probably damaging	0.96
R4448:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4450:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4457:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4458:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4466:Akap13	UTSW	7	75602773	splice site	probably null
R4632:Akap13	UTSW	7	75666553	missense	possibly damaging	0.91
R4667:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4669:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4671:Akap13	UTSW	7	75579564	nonsense	probably null
R4821:Akap13	UTSW	7	75677507	intron	probably benign
R4868:Akap13	UTSW	7	75743504	missense	probably damaging	1.00
R4894:Akap13	UTSW	7	75725320	missense	possibly damaging	0.76
R4943:Akap13	UTSW	7	75749240	missense	probably benign	0.22
R4962:Akap13	UTSW	7	75749430	missense	probably damaging	0.98
R4988:Akap13	UTSW	7	75730528	missense	probably damaging	1.00
R5119:Akap13	UTSW	7	75687252	missense	probably damaging	0.98
R5141:Akap13	UTSW	7	75609614	missense	probably benign	0.18
R5419:Akap13	UTSW	7	75610243	missense	probably benign	0.01
R5427:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R5429:Akap13	UTSW	7	75602904	missense	possibly damaging	0.70
R5432:Akap13	UTSW	7	75602830	missense	probably damaging	1.00
R5458:Akap13	UTSW	7	75586301	missense	probably damaging	1.00
R5636:Akap13	UTSW	7	75704372	missense	probably damaging	0.96
R5643:Akap13	UTSW	7	75702154	critical splice donor site	probably null
R5898:Akap13	UTSW	7	75729146	missense	probably damaging	1.00
R5932:Akap13	UTSW	7	75610184	missense	probably damaging	1.00
R6135:Akap13	UTSW	7	75609908	missense	possibly damaging	0.94
R6137:Akap13	UTSW	7	75677416	missense	probably damaging	1.00
R6182:Akap13	UTSW	7	75586280	missense	probably benign	0.45
R6310:Akap13	UTSW	7	75749193	missense	probably damaging	0.99
R6346:Akap13	UTSW	7	75685254	missense	probably damaging	1.00
R6466:Akap13	UTSW	7	75727044	missense	probably benign	0.01
R6605:Akap13	UTSW	7	75579768	missense	probably damaging	0.98
R6617:Akap13	UTSW	7	75730363	missense	possibly damaging	0.95
R6621:Akap13	UTSW	7	75569981	missense	probably damaging	1.00
R6703:Akap13	UTSW	7	75602898	missense	probably damaging	1.00
R6750:Akap13	UTSW	7	75739458	missense	probably benign	0.03
R7069:Akap13	UTSW	7	75610262	missense	probably benign	0.29
R7116:Akap13	UTSW	7	75720195	missense	probably benign	0.00
R7158:Akap13	UTSW	7	75579594	missense	probably damaging	0.97
R7159:Akap13	UTSW	7	75730579	missense	possibly damaging	0.72
R7467:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7468:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7471:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7472:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7477:Akap13	UTSW	7	75749247	missense	probably benign
R7636:Akap13	UTSW	7	75609873	missense	probably benign	0.04
R7650:Akap13	UTSW	7	75643454	missense	probably benign	0.20
R7671:Akap13	UTSW	7	75569900	missense	probably damaging	1.00
R7681:Akap13	UTSW	7	75728796	missense	possibly damaging	0.91
R7752:Akap13	UTSW	7	75677258	missense	possibly damaging	0.74
R7784:Akap13	UTSW	7	75610328	missense	probably benign	0.00
R7816:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7817:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7834:Akap13	UTSW	7	75742642	missense	possibly damaging	0.85
R7880:Akap13	UTSW	7	75586216	missense	probably damaging	0.97
R7942:Akap13	UTSW	7	75611470	missense	possibly damaging	0.50
R8006:Akap13	UTSW	7	75579696	missense	probably damaging	1.00
R8009:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8011:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8012:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8013:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8016:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8089:Akap13	UTSW	7	75610592	missense	possibly damaging	0.94
R8138:Akap13	UTSW	7	75702231	splice site	probably null
R8174:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R8298:Akap13	UTSW	7	75747804	missense	probably damaging	1.00
R8444:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8445:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8465:Akap13	UTSW	7	75727038	missense	probably benign	0.11
R8512:Akap13	UTSW	7	75611086	missense	probably damaging	0.99
R8523:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8793:Akap13	UTSW	7	75725328	missense	probably benign	0.35
R8907:Akap13	UTSW	7	75610696	missense	probably benign	0.08
R8907:Akap13	UTSW	7	75610708	missense	probably damaging	0.99
R8928:Akap13	UTSW	7	75609858	missense	probably benign	0.00
R8929:Akap13	UTSW	7	75609004	missense	probably benign	0.00
R8937:Akap13	UTSW	7	75534853	critical splice donor site	probably null
R8967:Akap13	UTSW	7	75729134	missense	possibly damaging	0.80
R8986:Akap13	UTSW	7	75609326	missense	probably benign
R9152:Akap13	UTSW	7	75611285	missense	probably damaging	0.98
R9153:Akap13	UTSW	7	75609481	missense	probably benign	0.00
R9160:Akap13	UTSW	7	75735778	missense	possibly damaging	0.88
R9192:Akap13	UTSW	7	75704501	missense	probably benign	0.06
R9319:Akap13	UTSW	7	75609088	missense	probably benign	0.01
R9513:Akap13	UTSW	7	75704527	missense	probably benign	0.01
R9515:Akap13	UTSW	7	75704527	missense	probably benign	0.01
R9516:Akap13	UTSW	7	75704527	missense	probably benign	0.01
R9523:Akap13	UTSW	7	75643445	missense
R9564:Akap13	UTSW	7	75609413	missense	probably benign
Z1176:Akap13	UTSW	7	75730552	missense	probably damaging	0.99
Z1177:Akap13	UTSW	7	75615005	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AAAACTTACCTTGCTGTTGACC -3'
(R):5'- GGTAACGTATGCTAGGACATACAC -3'

Sequencing Primer
(F):5'- GTCTCAAAAGTTGGGCTAAGATTG -3'
(R):5'- CGTATGCTAGGACATACACTGAATC -3'

Posted On

2014-09-17