Incidental Mutation 'R0158:Adam19'
ID 22992
Institutional Source Beutler Lab
Gene Symbol Adam19
Ensembl Gene ENSMUSG00000011256
Gene Name a disintegrin and metallopeptidase domain 19 (meltrin beta)
Synonyms Mltnb
MMRRC Submission 038438-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0158 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 11
Chromosomal Location 46055992-46147343 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 46143034 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 891 (P891L)
Ref Sequence ENSEMBL: ENSMUSP00000011400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011400]
AlphaFold O35674
Predicted Effect probably damaging
Transcript: ENSMUST00000011400
AA Change: P891L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: P891L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 163 9.4e-27 PFAM
Pfam:Reprolysin_5 209 388 1.9e-25 PFAM
Pfam:Reprolysin_4 209 399 1.5e-15 PFAM
Pfam:Reprolysin 211 409 1.3e-68 PFAM
Pfam:Reprolysin_2 231 399 6.1e-19 PFAM
Pfam:Reprolysin_3 235 357 1.2e-19 PFAM
DISIN 426 501 9.7e-41 SMART
ACR 502 650 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
low complexity region 788 797 N/A INTRINSIC
low complexity region 832 846 N/A INTRINSIC
low complexity region 886 905 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156446
Meta Mutation Damage Score 0.1059 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 93% (79/85)
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T G 1: 26,683,951 H716P probably damaging Het
9530053A07Rik A G 7: 28,155,492 I1848V probably damaging Het
Abcf3 C T 16: 20,552,566 R437C probably damaging Het
Abhd3 A G 18: 10,647,840 Y315H possibly damaging Het
Ampd1 T A 3: 103,091,730 Y400* probably null Het
Ap1g1 T C 8: 109,855,635 S724P probably benign Het
BC067074 T A 13: 113,369,153 L2272* probably null Het
Bst2 T A 8: 71,537,217 T71S possibly damaging Het
C3 A G 17: 57,224,851 probably null Het
Cacna2d1 C A 5: 16,361,817 probably benign Het
Cacna2d4 C T 6: 119,236,748 H43Y possibly damaging Het
Ccdc71 T G 9: 108,464,137 V383G probably benign Het
Cd109 A T 9: 78,688,932 Q849L possibly damaging Het
Cdkn2a A T 4: 89,276,767 H115Q possibly damaging Het
Ces1e T C 8: 93,219,429 E161G probably benign Het
Cggbp1 C T 16: 64,855,838 S89L possibly damaging Het
Crocc A T 4: 141,042,242 probably benign Het
Eef1akmt3 G A 10: 127,033,273 Q111* probably null Het
Exoc7 T C 11: 116,295,292 N361S probably benign Het
Fat2 G T 11: 55,296,185 S1278R probably benign Het
Fbxo42 A G 4: 141,200,329 N640S probably benign Het
Fbxw25 A G 9: 109,654,652 V164A possibly damaging Het
Foxs1 T C 2: 152,932,410 E241G probably damaging Het
Fras1 A T 5: 96,776,634 I3645F possibly damaging Het
Gm14496 T A 2: 181,997,413 V432E probably benign Het
Herc1 T A 9: 66,495,921 L4374* probably null Het
Hist1h3b T A 13: 23,752,710 C111S probably damaging Het
Ift122 T C 6: 115,924,484 probably benign Het
Itgav C A 2: 83,792,037 N654K probably benign Het
Itih5 T C 2: 10,234,992 probably benign Het
Jak2 C A 19: 29,311,757 T1103K probably benign Het
Kcnc4 C A 3: 107,458,604 C96F probably benign Het
Med13l C A 5: 118,742,449 S1202Y unknown Het
Mefv T C 16: 3,715,456 E317G possibly damaging Het
Ncoa2 T C 1: 13,152,384 T1226A probably benign Het
Nktr C T 9: 121,750,691 probably benign Het
Nudt5 G A 2: 5,862,303 V61M probably damaging Het
Olfr33 C T 7: 102,713,955 A153T probably benign Het
Palm2 A G 4: 57,709,649 D198G possibly damaging Het
Papd5 G A 8: 88,250,743 G391D probably damaging Het
Pcdhb2 A C 18: 37,297,230 Y752S probably damaging Het
Pcnx4 A G 12: 72,556,302 D446G probably benign Het
Pnp2 G A 14: 50,964,304 R249H probably damaging Het
Rgs3 A T 4: 62,623,884 I32F probably damaging Het
Rnf139 A G 15: 58,898,878 T251A probably benign Het
Rnf41 A G 10: 128,438,235 E252G probably damaging Het
Rxfp2 T A 5: 150,051,628 F220Y probably benign Het
Sdcbp A G 4: 6,379,042 D43G possibly damaging Het
Serpina3f A G 12: 104,217,008 D43G probably damaging Het
Sftpc T C 14: 70,521,447 K154R probably null Het
Simc1 A G 13: 54,524,717 T293A probably benign Het
Skint6 A T 4: 113,184,814 probably benign Het
Slc6a15 T C 10: 103,389,347 probably benign Het
Ston2 A T 12: 91,740,602 I78N probably damaging Het
Taok3 T C 5: 117,217,242 probably null Het
Tiam1 C T 16: 89,793,001 probably benign Het
Tnfsf15 T C 4: 63,729,992 H137R possibly damaging Het
Tpte G A 8: 22,327,739 R247H possibly damaging Het
Trim2 T C 3: 84,210,169 probably benign Het
Ulk1 A T 5: 110,788,944 probably benign Het
Utp4 T G 8: 106,913,386 H442Q probably null Het
Vmn1r193 T A 13: 22,219,628 I65F probably damaging Het
Vps54 A T 11: 21,306,962 Q690L probably damaging Het
Ybx2 T C 11: 69,940,319 probably benign Het
Zbtb38 C T 9: 96,686,940 G697D possibly damaging Het
Zfp202 C T 9: 40,208,916 Q218* probably null Het
Zfp820 G A 17: 21,819,819 T176I probably benign Het
Other mutations in Adam19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Adam19 APN 11 46112783 missense probably damaging 1.00
IGL01727:Adam19 APN 11 46121553 missense probably benign
IGL01758:Adam19 APN 11 46112924 missense probably benign 0.01
IGL02160:Adam19 APN 11 46139695 missense probably damaging 0.99
IGL02421:Adam19 APN 11 46137553 missense probably damaging 0.96
IGL02572:Adam19 APN 11 46131721 nonsense probably null
IGL02995:Adam19 APN 11 46136349 missense probably benign 0.00
IGL03171:Adam19 APN 11 46138854 missense probably damaging 0.98
IGL03237:Adam19 APN 11 46137556 missense probably benign
R0003:Adam19 UTSW 11 46128789 missense probably damaging 1.00
R0026:Adam19 UTSW 11 46136259 missense probably damaging 1.00
R0304:Adam19 UTSW 11 46127392 missense possibly damaging 0.91
R0488:Adam19 UTSW 11 46138930 missense probably damaging 0.98
R0501:Adam19 UTSW 11 46123130 missense probably damaging 1.00
R0591:Adam19 UTSW 11 46121411 splice site probably benign
R0734:Adam19 UTSW 11 46127403 missense probably damaging 0.99
R0747:Adam19 UTSW 11 46118495 splice site probably null
R0771:Adam19 UTSW 11 46121453 missense possibly damaging 0.92
R1052:Adam19 UTSW 11 46127265 missense probably damaging 0.99
R1573:Adam19 UTSW 11 46113618 splice site probably benign
R1735:Adam19 UTSW 11 46138917 missense probably benign 0.26
R1830:Adam19 UTSW 11 46127278 missense probably damaging 0.98
R1911:Adam19 UTSW 11 46121454 missense probably damaging 1.00
R2092:Adam19 UTSW 11 46060904 splice site probably null
R3749:Adam19 UTSW 11 46137610 missense probably benign 0.00
R3893:Adam19 UTSW 11 46128838 missense probably damaging 1.00
R3916:Adam19 UTSW 11 46060935 missense probably benign 0.25
R3917:Adam19 UTSW 11 46060935 missense probably benign 0.25
R4506:Adam19 UTSW 11 46118444 missense possibly damaging 0.67
R4767:Adam19 UTSW 11 46138977 critical splice donor site probably null
R5055:Adam19 UTSW 11 46123169 missense probably damaging 1.00
R5313:Adam19 UTSW 11 46131776 missense probably damaging 1.00
R5329:Adam19 UTSW 11 46125026 missense probably damaging 0.99
R5567:Adam19 UTSW 11 46136250 missense probably damaging 1.00
R5602:Adam19 UTSW 11 46136315 missense probably benign
R6198:Adam19 UTSW 11 46121502 missense probably damaging 1.00
R6875:Adam19 UTSW 11 46112875 missense probably benign
R7011:Adam19 UTSW 11 46143018 missense probably benign 0.00
R7163:Adam19 UTSW 11 46131717 missense probably benign
R7213:Adam19 UTSW 11 46121471 missense probably benign 0.20
R7267:Adam19 UTSW 11 46121576 nonsense probably null
R7896:Adam19 UTSW 11 46137543 missense probably damaging 1.00
R8012:Adam19 UTSW 11 46065046 missense possibly damaging 0.74
R8059:Adam19 UTSW 11 46136466 splice site probably benign
R8243:Adam19 UTSW 11 46125082 missense probably damaging 1.00
R8357:Adam19 UTSW 11 46140112 missense probably damaging 0.96
R8419:Adam19 UTSW 11 46125023 missense possibly damaging 0.77
R8457:Adam19 UTSW 11 46140112 missense probably damaging 0.96
R9163:Adam19 UTSW 11 46127349 missense probably benign 0.02
R9349:Adam19 UTSW 11 46131743 nonsense probably null
R9489:Adam19 UTSW 11 46137622 missense probably benign 0.10
X0067:Adam19 UTSW 11 46056115 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- TTGAAGGGAGACCCTCAAGTCAGAC -3'
(R):5'- TTCAGGTGCCATCAAAGCCACCAG -3'

Sequencing Primer
(F):5'- ACCCTCAAGTCAGACTTCTTGC -3'
(R):5'- TGCTCATGTAAGGTACAGCC -3'
Posted On 2013-04-16