Mutagenetix > Incidental Mutation

Incidental Mutation 'R2126:Lasp1'

229920

Institutional Source

Beutler Lab

Gene Symbol

Lasp1

Ensembl Gene

ENSMUSG00000038366

Gene Name

LIM and SH3 protein 1

Synonyms

Tg(Col1a1-lacZ)1Ngma, Def-4, Tg(11Col1a1)NG, SH3P6

MMRRC Submission

040129-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R2126 (G1)

Quality Score

165

Status

Not validated

Chromosome

Chromosomal Location

97799000-97838764 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 97836134 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 227 (D227E)

Ref Sequence

ENSEMBL: ENSMUSP00000042123 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043843] [ENSMUST00000054783] [ENSMUST00000129558] [ENSMUST00000129828] [ENSMUST00000146572] [ENSMUST00000148280] [ENSMUST00000152962]

AlphaFold

Q61792

Predicted Effect

probably benign
Transcript: ENSMUST00000043843
AA Change: D227E

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000042123
Gene: ENSMUSG00000038366
AA Change: D227E

Domain	Start	End	E-Value	Type
LIM	4	56	4.34e-15	SMART
NEBU	62	92	1.1e-8	SMART
NEBU	98	128	1.05e-9	SMART
low complexity region	174	180	N/A	INTRINSIC
SH3	207	263	8.11e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000054783

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107568

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127575

Predicted Effect

probably benign
Transcript: ENSMUST00000129558

SMART Domains

Protein: ENSMUSP00000123165
Gene: ENSMUSG00000038366

Domain	Start	End	E-Value	Type
Blast:LIM	1	20	4e-7	BLAST
NEBU	26	56	1.1e-8	SMART
NEBU	62	92	1.05e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129828

SMART Domains

Protein: ENSMUSP00000115308
Gene: ENSMUSG00000038366

Domain	Start	End	E-Value	Type
Blast:LIM	1	20	4e-7	BLAST
NEBU	26	56	1.1e-8	SMART
NEBU	62	92	1.05e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146572

SMART Domains

Protein: ENSMUSP00000121907
Gene: ENSMUSG00000038366

Domain	Start	End	E-Value	Type
Blast:LIM	1	20	3e-7	BLAST
Pfam:Nebulin	31	59	2.1e-12	PFAM
Pfam:Nebulin	67	89	1.5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148280

SMART Domains

Protein: ENSMUSP00000123050
Gene: ENSMUSG00000038366

Domain	Start	End	E-Value	Type
Blast:LIM	1	20	2e-7	BLAST
NEBU	26	56	1.1e-8	SMART
NEBU	62	92	1.05e-9	SMART
low complexity region	138	144	N/A	INTRINSIC
SCOP:d1awj__	155	186	7e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000152962

SMART Domains

Protein: ENSMUSP00000120645
Gene: ENSMUSG00000038366

Domain	Start	End	E-Value	Type
Blast:LIM	1	20	4e-7	BLAST
NEBU	26	56	1.1e-8	SMART
NEBU	62	92	1.05e-9	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM proteins, characterized by a LIM motif and a domain of Src homology region 3, and also a member of the nebulin family of actin-binding proteins. The encoded protein is a cAMP and cGMP dependent signaling protein and binds to the actin cytoskeleton at extensions of the cell membrane. The encoded protein has been linked to metastatic breast cancer, hematopoetic tumors such as B-cell lymphomas, and colorectal cancer. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced histamine-stimulated gastric acid secretion and enlarged heart and testes on a mixed background. Mice homozygous for a transgene insertion exhibit abnormal tail vertebrae with scoliosis, transient spina bifida occulta, and a bent tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadac	A	G	3: 60,039,645	T255A	possibly damaging	Het
Acat3	C	T	17: 12,927,407	A230T	probably benign	Het
Acsl1	C	A	8: 46,533,626	P650Q	probably benign	Het
Adgrl3	T	A	5: 81,512,536	I316N	probably damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
AI429214	T	A	8: 36,994,208	V170E	probably benign	Het
Akap13	G	A	7: 75,725,304	G1895S	possibly damaging	Het
Alpk2	G	A	18: 65,350,368	Q190*	probably null	Het
Aox3	C	A	1: 58,158,216	Q574K	probably benign	Het
Apeh	A	G	9: 108,085,667	Y702H	probably damaging	Het
Aqp11	A	G	7: 97,737,485	I151T	probably benign	Het
Arhgap28	A	G	17: 67,869,015	V363A	possibly damaging	Het
Arhgef18	A	G	8: 3,451,939	N699S	probably damaging	Het
Asnsd1	A	G	1: 53,347,317	S384P	probably benign	Het
Atl1	G	T	12: 69,931,657		probably null	Het
Atp13a2	A	T	4: 140,995,391	D203V	possibly damaging	Het
Axdnd1	A	T	1: 156,333,214	N164K	probably benign	Het
Bnipl	T	A	3: 95,245,683	I162F	probably damaging	Het
Cacna1d	A	T	14: 30,123,163	L655I	probably damaging	Het
Canx	T	C	11: 50,304,358	I294M	probably damaging	Het
Casz1	T	C	4: 148,946,064	F1180S	probably damaging	Het
Cav3	T	C	6: 112,472,383	Y121H	probably benign	Het
Cd4	A	C	6: 124,870,536	S222A	probably benign	Het
Cds1	T	C	5: 101,812,550	I289T	probably benign	Het
Cep112	T	C	11: 108,508,258	F328L	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap44	A	T	16: 44,410,475	D273V	probably benign	Het
Clec7a	C	T	6: 129,470,955	G49D	probably benign	Het
Col22a1	G	A	15: 71,857,253	Q599*	probably null	Het
Col6a5	T	A	9: 105,945,600	H186L	unknown	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnah12	A	T	14: 26,724,458	R725*	probably null	Het
Dnajc10	G	A	2: 80,350,734		probably null	Het
Edem3	A	T	1: 151,794,731	H337L	possibly damaging	Het
Eif2ak4	A	T	2: 118,422,123	H392L	probably benign	Het
Ercc6l2	G	A	13: 63,848,771	V365I	probably damaging	Het
Fam129a	A	C	1: 151,696,135	E277A	probably damaging	Het
Fam129a	A	G	1: 151,709,133	I494V	possibly damaging	Het
Fan1	T	C	7: 64,346,888	E978G	probably damaging	Het
Fcrl6	C	T	1: 172,599,248	V44M	probably benign	Het
Gaa	G	A	11: 119,270,282	W50*	probably null	Het
Gm10032	T	C	14: 66,792,778		noncoding transcript	Het
Gm10985	CTCTAT	CT	3: 53,845,249		probably null	Het
Gprc5b	G	T	7: 118,984,175	P157Q	probably damaging	Het
Gsdmc3	G	A	15: 63,858,534	Q394*	probably null	Het
Gucd1	A	G	10: 75,512,088	S38P	probably damaging	Het
Higd1a	A	T	9: 121,850,247	I58N	probably damaging	Het
Hmx3	G	C	7: 131,544,549	V329L	possibly damaging	Het
Hnrnpul2	A	T	19: 8,824,438	R337*	probably null	Het
Idua	T	A	5: 108,681,438	H368Q	possibly damaging	Het
Ifih1	A	G	2: 62,623,467	V218A	probably benign	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Klhl30	T	A	1: 91,358,777		probably null	Het
Lhx6	A	G	2: 36,091,324	I85T	possibly damaging	Het
Limch1	A	G	5: 67,029,760	D840G	probably damaging	Het
Loxl4	C	G	19: 42,603,963	E385D	probably damaging	Het
Lrrtm4	A	T	6: 80,021,739	I44F	probably damaging	Het
Ltbp2	T	C	12: 84,785,709		probably null	Het
Lyg1	T	C	1: 37,950,674	Y44C	probably damaging	Het
Maats1	T	C	16: 38,341,762	T6A	probably benign	Het
Map1a	A	G	2: 121,298,641	I129V	probably damaging	Het
Med27	C	T	2: 29,524,430	Q150*	probably null	Het
Ms4a5	A	T	19: 11,279,368	I55N	probably damaging	Het
Muc5ac	T	C	7: 141,810,742	S2597P	possibly damaging	Het
Mxd1	A	C	6: 86,651,440		probably null	Het
Myo3a	A	G	2: 22,578,174	D480G	probably benign	Het
Neb	T	C	2: 52,310,638	Y343C	probably damaging	Het
Nrn1	A	C	13: 36,730,206	V34G	probably damaging	Het
Olfr1090	A	T	2: 86,754,452	N95K	probably benign	Het
Olfr1099	T	C	2: 86,959,098	Y120C	possibly damaging	Het
Olfr1302	A	G	2: 111,780,496	M59V	probably damaging	Het
Olfr679	A	G	7: 105,086,615	T300A	probably damaging	Het
Olfr690	C	T	7: 105,329,252	W313*	probably null	Het
Olfr722	A	G	14: 49,895,067	I245T	probably benign	Het
Olfr887	G	T	9: 38,085,276	V147L	probably benign	Het
Pdia4	A	T	6: 47,796,837	V526E	probably damaging	Het
Pdia6	T	C	12: 17,278,545	V167A	probably damaging	Het
Pgk2	A	G	17: 40,207,509	F343L	probably damaging	Het
Piwil1	T	C	5: 128,754,096	V827A	probably damaging	Het
Plag1	A	T	4: 3,904,169	Y341N	possibly damaging	Het
Plch2	T	C	4: 154,998,999	E393G	probably damaging	Het
Ptprg	T	A	14: 12,154,355	M692K	probably benign	Het
Rassf8	G	A	6: 145,815,182	R78H	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf213	A	G	11: 119,450,201	Q3556R	probably damaging	Het
Rpa2	T	C	4: 132,768,788		probably null	Het
Rpe	T	G	1: 66,715,980	F174V	possibly damaging	Het
Sbf2	T	C	7: 110,560,295	D36G	probably damaging	Het
Scn2a	T	A	2: 65,752,079	Y1590*	probably null	Het
Slc24a4	T	C	12: 102,222,759	V151A	probably damaging	Het
Slc30a8	A	T	15: 52,295,934	M17L	probably benign	Het
Slit3	T	C	11: 35,688,679	Y1228H	probably damaging	Het
Smad4	G	A	18: 73,662,744	T193M	probably benign	Het
Smtn	T	A	11: 3,530,045	H392L	probably benign	Het
St8sia3	A	G	18: 64,269,674	D128G	probably damaging	Het
Sucla2	A	T	14: 73,592,668	M382L	possibly damaging	Het
Tbx5	A	G	5: 119,836,923	T4A	probably benign	Het
Tdrd5	T	C	1: 156,276,573	R528G	probably damaging	Het
Tex44	T	C	1: 86,427,089	L240P	probably benign	Het
Tns4	A	T	11: 99,080,078		probably null	Het
Trappc10	A	T	10: 78,203,924	V731E	possibly damaging	Het
Ttf1	A	G	2: 29,071,345	K582E	probably damaging	Het
Ttf2	C	A	3: 100,948,193	Q895H	possibly damaging	Het
Ttll6	A	G	11: 96,147,532	E402G	probably damaging	Het
Ttn	A	T	2: 76,890,092		probably null	Het
Ugt8a	T	C	3: 125,875,546	D303G	probably damaging	Het
Ulk1	G	T	5: 110,792,436	A373D	probably benign	Het
Vmn2r13	A	G	5: 109,158,192	S507P	probably benign	Het
Vmn2r19	T	A	6: 123,316,074	D358E	possibly damaging	Het
Vmn2r88	T	C	14: 51,413,807	S201P	probably benign	Het
Zfp36l2	A	G	17: 84,186,975	F78S	probably damaging	Het
Zfp454	A	C	11: 50,873,995	S203R	probably benign	Het
Zfp616	C	A	11: 74,085,403	Q833K	probably benign	Het
Znhit2	A	G	19: 6,062,061	T279A	probably benign	Het
Zswim3	T	A	2: 164,819,993	I131N	probably benign	Het

Other mutations in Lasp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01296:Lasp1	APN	11	97836190	missense	probably damaging	1.00
R0281:Lasp1	UTSW	11	97806851	nonsense	probably null
R3906:Lasp1	UTSW	11	97799827	missense	probably damaging	1.00
R3908:Lasp1	UTSW	11	97799827	missense	probably damaging	1.00
R3909:Lasp1	UTSW	11	97799827	missense	probably damaging	1.00
R4908:Lasp1	UTSW	11	97833704	critical splice donor site	probably null
R5239:Lasp1	UTSW	11	97799860	missense	probably damaging	1.00
R6519:Lasp1	UTSW	11	97815557	splice site	probably null
R6576:Lasp1	UTSW	11	97833576	missense	probably damaging	1.00
R6629:Lasp1	UTSW	11	97806896	nonsense	probably null
R7001:Lasp1	UTSW	11	97806833	missense	probably damaging	1.00
R8063:Lasp1	UTSW	11	97834131	missense	probably benign	0.00
R8708:Lasp1	UTSW	11	97806883	missense	possibly damaging	0.67
R9710:Lasp1	UTSW	11	97806767	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGGCTGCATCTTCCGATTC -3'
(R):5'- CAGGACAGATGTGATGCCATG -3'

Sequencing Primer
(F):5'- TTCCCCCAAGATCTCTGAGAGGTAG -3'
(R):5'- TGCCATGGAATGCATTGAAGAC -3'

Posted On

2014-09-17