Incidental Mutation 'R2126:Rnf213'
ID 229925
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Name ring finger protein 213
Synonyms D11Ertd759e
MMRRC Submission 040129-MU
Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2126 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 119393100-119487418 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119450201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 3556 (Q3556R)
Ref Sequence ENSEMBL: ENSMUSP00000115063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000093902
AA Change: Q3557R

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: Q3557R

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000131035
AA Change: Q3556R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: Q3556R

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207133
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A G 3: 60,039,645 T255A possibly damaging Het
Acat3 C T 17: 12,927,407 A230T probably benign Het
Acsl1 C A 8: 46,533,626 P650Q probably benign Het
Adgrl3 T A 5: 81,512,536 I316N probably damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
AI429214 T A 8: 36,994,208 V170E probably benign Het
Akap13 G A 7: 75,725,304 G1895S possibly damaging Het
Alpk2 G A 18: 65,350,368 Q190* probably null Het
Aox3 C A 1: 58,158,216 Q574K probably benign Het
Apeh A G 9: 108,085,667 Y702H probably damaging Het
Aqp11 A G 7: 97,737,485 I151T probably benign Het
Arhgap28 A G 17: 67,869,015 V363A possibly damaging Het
Arhgef18 A G 8: 3,451,939 N699S probably damaging Het
Asnsd1 A G 1: 53,347,317 S384P probably benign Het
Atl1 G T 12: 69,931,657 probably null Het
Atp13a2 A T 4: 140,995,391 D203V possibly damaging Het
Axdnd1 A T 1: 156,333,214 N164K probably benign Het
Bnipl T A 3: 95,245,683 I162F probably damaging Het
Cacna1d A T 14: 30,123,163 L655I probably damaging Het
Canx T C 11: 50,304,358 I294M probably damaging Het
Casz1 T C 4: 148,946,064 F1180S probably damaging Het
Cav3 T C 6: 112,472,383 Y121H probably benign Het
Cd4 A C 6: 124,870,536 S222A probably benign Het
Cds1 T C 5: 101,812,550 I289T probably benign Het
Cep112 T C 11: 108,508,258 F328L probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap44 A T 16: 44,410,475 D273V probably benign Het
Clec7a C T 6: 129,470,955 G49D probably benign Het
Col22a1 G A 15: 71,857,253 Q599* probably null Het
Col6a5 T A 9: 105,945,600 H186L unknown Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 A T 14: 26,724,458 R725* probably null Het
Dnajc10 G A 2: 80,350,734 probably null Het
Edem3 A T 1: 151,794,731 H337L possibly damaging Het
Eif2ak4 A T 2: 118,422,123 H392L probably benign Het
Ercc6l2 G A 13: 63,848,771 V365I probably damaging Het
Fam129a A C 1: 151,696,135 E277A probably damaging Het
Fam129a A G 1: 151,709,133 I494V possibly damaging Het
Fan1 T C 7: 64,346,888 E978G probably damaging Het
Fcrl6 C T 1: 172,599,248 V44M probably benign Het
Gaa G A 11: 119,270,282 W50* probably null Het
Gm10032 T C 14: 66,792,778 noncoding transcript Het
Gm10985 CTCTAT CT 3: 53,845,249 probably null Het
Gprc5b G T 7: 118,984,175 P157Q probably damaging Het
Gsdmc3 G A 15: 63,858,534 Q394* probably null Het
Gucd1 A G 10: 75,512,088 S38P probably damaging Het
Higd1a A T 9: 121,850,247 I58N probably damaging Het
Hmx3 G C 7: 131,544,549 V329L possibly damaging Het
Hnrnpul2 A T 19: 8,824,438 R337* probably null Het
Idua T A 5: 108,681,438 H368Q possibly damaging Het
Ifih1 A G 2: 62,623,467 V218A probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl30 T A 1: 91,358,777 probably null Het
Lasp1 T A 11: 97,836,134 D227E probably benign Het
Lhx6 A G 2: 36,091,324 I85T possibly damaging Het
Limch1 A G 5: 67,029,760 D840G probably damaging Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrrtm4 A T 6: 80,021,739 I44F probably damaging Het
Ltbp2 T C 12: 84,785,709 probably null Het
Lyg1 T C 1: 37,950,674 Y44C probably damaging Het
Maats1 T C 16: 38,341,762 T6A probably benign Het
Map1a A G 2: 121,298,641 I129V probably damaging Het
Med27 C T 2: 29,524,430 Q150* probably null Het
Ms4a5 A T 19: 11,279,368 I55N probably damaging Het
Muc5ac T C 7: 141,810,742 S2597P possibly damaging Het
Mxd1 A C 6: 86,651,440 probably null Het
Myo3a A G 2: 22,578,174 D480G probably benign Het
Neb T C 2: 52,310,638 Y343C probably damaging Het
Nrn1 A C 13: 36,730,206 V34G probably damaging Het
Olfr1090 A T 2: 86,754,452 N95K probably benign Het
Olfr1099 T C 2: 86,959,098 Y120C possibly damaging Het
Olfr1302 A G 2: 111,780,496 M59V probably damaging Het
Olfr679 A G 7: 105,086,615 T300A probably damaging Het
Olfr690 C T 7: 105,329,252 W313* probably null Het
Olfr722 A G 14: 49,895,067 I245T probably benign Het
Olfr887 G T 9: 38,085,276 V147L probably benign Het
Pdia4 A T 6: 47,796,837 V526E probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Pgk2 A G 17: 40,207,509 F343L probably damaging Het
Piwil1 T C 5: 128,754,096 V827A probably damaging Het
Plag1 A T 4: 3,904,169 Y341N possibly damaging Het
Plch2 T C 4: 154,998,999 E393G probably damaging Het
Ptprg T A 14: 12,154,355 M692K probably benign Het
Rassf8 G A 6: 145,815,182 R78H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpa2 T C 4: 132,768,788 probably null Het
Rpe T G 1: 66,715,980 F174V possibly damaging Het
Sbf2 T C 7: 110,560,295 D36G probably damaging Het
Scn2a T A 2: 65,752,079 Y1590* probably null Het
Slc24a4 T C 12: 102,222,759 V151A probably damaging Het
Slc30a8 A T 15: 52,295,934 M17L probably benign Het
Slit3 T C 11: 35,688,679 Y1228H probably damaging Het
Smad4 G A 18: 73,662,744 T193M probably benign Het
Smtn T A 11: 3,530,045 H392L probably benign Het
St8sia3 A G 18: 64,269,674 D128G probably damaging Het
Sucla2 A T 14: 73,592,668 M382L possibly damaging Het
Tbx5 A G 5: 119,836,923 T4A probably benign Het
Tdrd5 T C 1: 156,276,573 R528G probably damaging Het
Tex44 T C 1: 86,427,089 L240P probably benign Het
Tns4 A T 11: 99,080,078 probably null Het
Trappc10 A T 10: 78,203,924 V731E possibly damaging Het
Ttf1 A G 2: 29,071,345 K582E probably damaging Het
Ttf2 C A 3: 100,948,193 Q895H possibly damaging Het
Ttll6 A G 11: 96,147,532 E402G probably damaging Het
Ttn A T 2: 76,890,092 probably null Het
Ugt8a T C 3: 125,875,546 D303G probably damaging Het
Ulk1 G T 5: 110,792,436 A373D probably benign Het
Vmn2r13 A G 5: 109,158,192 S507P probably benign Het
Vmn2r19 T A 6: 123,316,074 D358E possibly damaging Het
Vmn2r88 T C 14: 51,413,807 S201P probably benign Het
Zfp36l2 A G 17: 84,186,975 F78S probably damaging Het
Zfp454 A C 11: 50,873,995 S203R probably benign Het
Zfp616 C A 11: 74,085,403 Q833K probably benign Het
Znhit2 A G 19: 6,062,061 T279A probably benign Het
Zswim3 T A 2: 164,819,993 I131N probably benign Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119449343 missense probably benign 0.00
IGL00961:Rnf213 APN 11 119440843 missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119447237 missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119483118 missense probably benign 0.25
IGL01403:Rnf213 APN 11 119443300 missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119449876 critical splice donor site probably null
IGL01765:Rnf213 APN 11 119436352 missense probably benign 0.00
IGL01803:Rnf213 APN 11 119441307 missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119442266 missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119443015 missense probably benign 0.05
IGL01944:Rnf213 APN 11 119416457 missense probably benign 0.01
IGL01982:Rnf213 APN 11 119443268 missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119418309 splice site probably benign
IGL02084:Rnf213 APN 11 119445673 missense probably benign 0.04
IGL02253:Rnf213 APN 11 119440650 missense probably benign 0.03
IGL02254:Rnf213 APN 11 119480907 missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119463336 missense probably benign 0.01
IGL02531:Rnf213 APN 11 119436802 missense probably benign
IGL02588:Rnf213 APN 11 119416536 missense probably benign 0.30
IGL02615:Rnf213 APN 11 119440789 missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119435066 missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119427510 missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119479941 missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119445626 splice site probably benign
IGL03057:Rnf213 APN 11 119441087 missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119465007 missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119474172 missense probably benign 0.03
IGL03339:Rnf213 APN 11 119443004 missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119421468 missense probably benign 0.34
attrition UTSW 11 119430321 missense possibly damaging 0.77
defame UTSW 11 119430281 nonsense probably null
Derogate UTSW 11 119470210 missense probably damaging 1.00
dinky UTSW 11 119416458 missense probably damaging 0.99
G1funyon_rnf213_024 UTSW 11 119434742 missense
Impugn UTSW 11 119436823 nonsense probably null
R4332_Rnf213_642 UTSW 11 119436676 missense probably damaging 1.00
B6584:Rnf213 UTSW 11 119426069 missense probably damaging 0.97
G1Funyon:Rnf213 UTSW 11 119434742 missense
PIT4585001:Rnf213 UTSW 11 119458392 missense
R0008:Rnf213 UTSW 11 119465052 missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119441606 missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119402575 missense probably benign 0.41
R0114:Rnf213 UTSW 11 119414587 missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0132:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0138:Rnf213 UTSW 11 119416496 missense probably benign 0.05
R0144:Rnf213 UTSW 11 119479600 nonsense probably null
R0184:Rnf213 UTSW 11 119414521 missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119438105 nonsense probably null
R0365:Rnf213 UTSW 11 119426111 missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119447257 missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119426012 missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119443120 missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119465082 missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119443280 missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119431717 missense probably benign 0.03
R0638:Rnf213 UTSW 11 119470210 missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119441834 missense probably benign 0.28
R0715:Rnf213 UTSW 11 119441150 missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119441068 missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119473480 missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119423095 critical splice donor site probably null
R0890:Rnf213 UTSW 11 119430486 missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119414570 missense probably benign 0.00
R0940:Rnf213 UTSW 11 119416563 missense probably benign 0.10
R0959:Rnf213 UTSW 11 119452581 missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119485998 splice site probably benign
R1104:Rnf213 UTSW 11 119477229 missense probably benign 0.29
R1141:Rnf213 UTSW 11 119435983 missense probably benign 0.02
R1219:Rnf213 UTSW 11 119436177 missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119436005 missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119442400 missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119437750 missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119480889 missense probably benign 0.05
R1523:Rnf213 UTSW 11 119441888 missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119442707 missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119441839 missense probably benign 0.06
R1563:Rnf213 UTSW 11 119414526 missense probably benign 0.13
R1572:Rnf213 UTSW 11 119436611 missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119463345 missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119442579 missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119437672 missense probably benign 0.01
R1789:Rnf213 UTSW 11 119440221 missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119441183 missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119450129 missense probably benign 0.08
R1893:Rnf213 UTSW 11 119416448 missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119431685 missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119480895 missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119441107 missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119436022 missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119461918 missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119467302 nonsense probably null
R2109:Rnf213 UTSW 11 119442663 nonsense probably null
R2115:Rnf213 UTSW 11 119428013 missense probably benign 0.00
R2144:Rnf213 UTSW 11 119443690 missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119415193 missense probably benign 0.03
R2168:Rnf213 UTSW 11 119415070 missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R2199:Rnf213 UTSW 11 119460009 missense probably benign 0.01
R2220:Rnf213 UTSW 11 119436428 missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119414604 missense probably benign 0.02
R2400:Rnf213 UTSW 11 119443195 missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119459938 splice site probably null
R2698:Rnf213 UTSW 11 119410144 missense probably benign 0.26
R3151:Rnf213 UTSW 11 119468892 missense probably benign 0.03
R3607:Rnf213 UTSW 11 119441976 nonsense probably null
R3808:Rnf213 UTSW 11 119479558 missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119480939 splice site probably benign
R3856:Rnf213 UTSW 11 119480939 splice site probably benign
R3973:Rnf213 UTSW 11 119469053 missense
R4014:Rnf213 UTSW 11 119445729 nonsense probably null
R4049:Rnf213 UTSW 11 119482448 missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119483006 missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119409482 missense probably benign 0.27
R4167:Rnf213 UTSW 11 119441243 missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119436823 nonsense probably null
R4332:Rnf213 UTSW 11 119436676 missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119483964 missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119479670 critical splice donor site probably null
R4609:Rnf213 UTSW 11 119437695 missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119441125 missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119440349 missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R4751:Rnf213 UTSW 11 119445745 missense probably benign 0.12
R4828:Rnf213 UTSW 11 119416629 missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119442763 missense probably benign 0.00
R4894:Rnf213 UTSW 11 119481240 missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119428157 missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119436764 missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119410807 missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119458866 missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119440816 missense probably benign 0.00
R5406:Rnf213 UTSW 11 119440808 missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119409020 missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119415076 missense probably benign 0.44
R5520:Rnf213 UTSW 11 119433499 missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119436629 missense probably benign 0.04
R5636:Rnf213 UTSW 11 119436905 missense probably damaging 1.00
R5669:Rnf213 UTSW 11 119458785 missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119434686 critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119483894 missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119416458 missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119436295 missense probably benign
R5861:Rnf213 UTSW 11 119473377 missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119421369 missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119443079 missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119486010 missense probably benign 0.00
R6043:Rnf213 UTSW 11 119442101 missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119416559 missense probably benign 0.14
R6123:Rnf213 UTSW 11 119411513 missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119411470 missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119442028 missense probably benign 0.02
R6146:Rnf213 UTSW 11 119435999 missense probably benign 0.41
R6163:Rnf213 UTSW 11 119458428 missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119414548 missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119463366 missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119477078 missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119459966 missense probably benign 0.03
R6468:Rnf213 UTSW 11 119452687 missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119436280 missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119479920 missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119430321 missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119442271 missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119442236 missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119462285 critical splice donor site probably null
R6820:Rnf213 UTSW 11 119448838 missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119449866 missense probably benign 0.26
R6934:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R7026:Rnf213 UTSW 11 119479655 missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119437604 splice site probably null
R7170:Rnf213 UTSW 11 119452575 missense
R7185:Rnf213 UTSW 11 119424198 missense
R7239:Rnf213 UTSW 11 119458788 missense
R7258:Rnf213 UTSW 11 119452575 missense
R7259:Rnf213 UTSW 11 119452575 missense
R7260:Rnf213 UTSW 11 119452575 missense
R7273:Rnf213 UTSW 11 119431756 splice site probably null
R7282:Rnf213 UTSW 11 119437992 missense
R7311:Rnf213 UTSW 11 119416547 missense
R7352:Rnf213 UTSW 11 119443579 missense
R7369:Rnf213 UTSW 11 119430468 missense
R7410:Rnf213 UTSW 11 119435051 missense
R7448:Rnf213 UTSW 11 119481291 missense
R7561:Rnf213 UTSW 11 119441719 missense
R7573:Rnf213 UTSW 11 119458484 missense
R7615:Rnf213 UTSW 11 119467297 missense
R7680:Rnf213 UTSW 11 119479556 missense
R7739:Rnf213 UTSW 11 119410861 missense
R7789:Rnf213 UTSW 11 119470219 splice site probably null
R7806:Rnf213 UTSW 11 119411545 missense
R8031:Rnf213 UTSW 11 119430281 nonsense probably null
R8042:Rnf213 UTSW 11 119441654 missense
R8053:Rnf213 UTSW 11 119402647 missense
R8284:Rnf213 UTSW 11 119428083 missense
R8301:Rnf213 UTSW 11 119434742 missense
R8325:Rnf213 UTSW 11 119430445 missense
R8332:Rnf213 UTSW 11 119483698 missense
R8443:Rnf213 UTSW 11 119449323 missense
R8518:Rnf213 UTSW 11 119462217 missense
R8531:Rnf213 UTSW 11 119474205 missense probably benign 0.02
R8670:Rnf213 UTSW 11 119458737 missense
R8675:Rnf213 UTSW 11 119456158 missense
R8690:Rnf213 UTSW 11 119418129 missense
R8690:Rnf213 UTSW 11 119441212 missense
R8714:Rnf213 UTSW 11 119468894 missense
R8802:Rnf213 UTSW 11 119462102 missense
R8861:Rnf213 UTSW 11 119442236 missense
R8886:Rnf213 UTSW 11 119473438 missense
R8893:Rnf213 UTSW 11 119443042 missense
R8937:Rnf213 UTSW 11 119430274 missense possibly damaging 0.94
R8941:Rnf213 UTSW 11 119414424 missense probably damaging 1.00
R8973:Rnf213 UTSW 11 119461930 missense
R8983:Rnf213 UTSW 11 119430349 missense
R9043:Rnf213 UTSW 11 119458913 missense
R9081:Rnf213 UTSW 11 119466236 missense
R9132:Rnf213 UTSW 11 119483916 missense
R9135:Rnf213 UTSW 11 119408747 missense
R9146:Rnf213 UTSW 11 119443673 missense
R9156:Rnf213 UTSW 11 119440748 missense
R9183:Rnf213 UTSW 11 119427622 missense
R9234:Rnf213 UTSW 11 119450117 missense
R9275:Rnf213 UTSW 11 119435942 missense
R9278:Rnf213 UTSW 11 119435942 missense
R9296:Rnf213 UTSW 11 119443795 splice site probably benign
R9350:Rnf213 UTSW 11 119442149 missense
R9366:Rnf213 UTSW 11 119436231 missense
R9413:Rnf213 UTSW 11 119466233 missense
R9444:Rnf213 UTSW 11 119434797 missense
R9464:Rnf213 UTSW 11 119463580 missense
R9605:Rnf213 UTSW 11 119469053 missense
R9649:Rnf213 UTSW 11 119479631 missense
R9651:Rnf213 UTSW 11 119440412 missense
R9664:Rnf213 UTSW 11 119441968 missense
R9696:Rnf213 UTSW 11 119468980 missense
R9710:Rnf213 UTSW 11 119441005 missense
R9797:Rnf213 UTSW 11 119442539 missense
S24628:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119441824 missense probably benign 0.14
X0062:Rnf213 UTSW 11 119473513 missense probably benign 0.05
X0064:Rnf213 UTSW 11 119440463 missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119477254 missense possibly damaging 0.69
Z1176:Rnf213 UTSW 11 119441410 missense
Z1176:Rnf213 UTSW 11 119482998 missense
Predicted Primers PCR Primer
(F):5'- AAACTTGCCTGGCCAAAGGG -3'
(R):5'- AGATGAGTCCCACCAACAGGAG -3'

Sequencing Primer
(F):5'- CAAAGGGTGAGCGGTTTCCTC -3'
(R):5'- GGAGCCCATCACTAACAGTAAC -3'
Posted On 2014-09-17