Incidental Mutation 'R2126:Alpk2'
ID229955
Institutional Source Beutler Lab
Gene Symbol Alpk2
Ensembl Gene ENSMUSG00000032845
Gene Namealpha-kinase 2
SynonymsHak
MMRRC Submission 040129-MU
Accession Numbers

Genbank: NM_001037294

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2126 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location65265529-65393888 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 65350368 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 190 (Q190*)
Ref Sequence ENSEMBL: ENSMUSP00000048752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]
Predicted Effect probably null
Transcript: ENSMUST00000035548
AA Change: Q190*
SMART Domains Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: Q190*

DomainStartEndE-ValueType
IGc2 24 94 9.34e-4 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1337 1353 N/A INTRINSIC
IG 1766 1849 2.27e-2 SMART
Alpha_kinase 1879 2098 3.72e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141250
SMART Domains Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845

DomainStartEndE-ValueType
low complexity region 255 267 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
IG 1299 1382 2.27e-2 SMART
Alpha_kinase 1412 1603 2.45e-56 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A G 3: 60,039,645 T255A possibly damaging Het
Acat3 C T 17: 12,927,407 A230T probably benign Het
Acsl1 C A 8: 46,533,626 P650Q probably benign Het
Adgrl3 T A 5: 81,512,536 I316N probably damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
AI429214 T A 8: 36,994,208 V170E probably benign Het
Akap13 G A 7: 75,725,304 G1895S possibly damaging Het
Aox3 C A 1: 58,158,216 Q574K probably benign Het
Apeh A G 9: 108,085,667 Y702H probably damaging Het
Aqp11 A G 7: 97,737,485 I151T probably benign Het
Arhgap28 A G 17: 67,869,015 V363A possibly damaging Het
Arhgef18 A G 8: 3,451,939 N699S probably damaging Het
Asnsd1 A G 1: 53,347,317 S384P probably benign Het
Atl1 G T 12: 69,931,657 probably null Het
Atp13a2 A T 4: 140,995,391 D203V possibly damaging Het
Axdnd1 A T 1: 156,333,214 N164K probably benign Het
Bnipl T A 3: 95,245,683 I162F probably damaging Het
Cacna1d A T 14: 30,123,163 L655I probably damaging Het
Canx T C 11: 50,304,358 I294M probably damaging Het
Casz1 T C 4: 148,946,064 F1180S probably damaging Het
Cav3 T C 6: 112,472,383 Y121H probably benign Het
Cd4 A C 6: 124,870,536 S222A probably benign Het
Cds1 T C 5: 101,812,550 I289T probably benign Het
Cep112 T C 11: 108,508,258 F328L probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap44 A T 16: 44,410,475 D273V probably benign Het
Clec7a C T 6: 129,470,955 G49D probably benign Het
Col22a1 G A 15: 71,857,253 Q599* probably null Het
Col6a5 T A 9: 105,945,600 H186L unknown Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 A T 14: 26,724,458 R725* probably null Het
Dnajc10 G A 2: 80,350,734 probably null Het
Edem3 A T 1: 151,794,731 H337L possibly damaging Het
Eif2ak4 A T 2: 118,422,123 H392L probably benign Het
Ercc6l2 G A 13: 63,848,771 V365I probably damaging Het
Fam129a A C 1: 151,696,135 E277A probably damaging Het
Fam129a A G 1: 151,709,133 I494V possibly damaging Het
Fan1 T C 7: 64,346,888 E978G probably damaging Het
Fcrl6 C T 1: 172,599,248 V44M probably benign Het
Gaa G A 11: 119,270,282 W50* probably null Het
Gm10032 T C 14: 66,792,778 noncoding transcript Het
Gm10985 CTCTAT CT 3: 53,845,249 probably null Het
Gprc5b G T 7: 118,984,175 P157Q probably damaging Het
Gsdmc3 G A 15: 63,858,534 Q394* probably null Het
Gucd1 A G 10: 75,512,088 S38P probably damaging Het
Higd1a A T 9: 121,850,247 I58N probably damaging Het
Hmx3 G C 7: 131,544,549 V329L possibly damaging Het
Hnrnpul2 A T 19: 8,824,438 R337* probably null Het
Idua T A 5: 108,681,438 H368Q possibly damaging Het
Ifih1 A G 2: 62,623,467 V218A probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl30 T A 1: 91,358,777 probably null Het
Lasp1 T A 11: 97,836,134 D227E probably benign Het
Lhx6 A G 2: 36,091,324 I85T possibly damaging Het
Limch1 A G 5: 67,029,760 D840G probably damaging Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrrtm4 A T 6: 80,021,739 I44F probably damaging Het
Ltbp2 T C 12: 84,785,709 probably null Het
Lyg1 T C 1: 37,950,674 Y44C probably damaging Het
Maats1 T C 16: 38,341,762 T6A probably benign Het
Map1a A G 2: 121,298,641 I129V probably damaging Het
Med27 C T 2: 29,524,430 Q150* probably null Het
Ms4a5 A T 19: 11,279,368 I55N probably damaging Het
Muc5ac T C 7: 141,810,742 S2597P possibly damaging Het
Mxd1 A C 6: 86,651,440 probably null Het
Myo3a A G 2: 22,578,174 D480G probably benign Het
Neb T C 2: 52,310,638 Y343C probably damaging Het
Nrn1 A C 13: 36,730,206 V34G probably damaging Het
Olfr1090 A T 2: 86,754,452 N95K probably benign Het
Olfr1099 T C 2: 86,959,098 Y120C possibly damaging Het
Olfr1302 A G 2: 111,780,496 M59V probably damaging Het
Olfr679 A G 7: 105,086,615 T300A probably damaging Het
Olfr690 C T 7: 105,329,252 W313* probably null Het
Olfr722 A G 14: 49,895,067 I245T probably benign Het
Olfr887 G T 9: 38,085,276 V147L probably benign Het
Pdia4 A T 6: 47,796,837 V526E probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Pgk2 A G 17: 40,207,509 F343L probably damaging Het
Piwil1 T C 5: 128,754,096 V827A probably damaging Het
Plag1 A T 4: 3,904,169 Y341N possibly damaging Het
Plch2 T C 4: 154,998,999 E393G probably damaging Het
Ptprg T A 14: 12,154,355 M692K probably benign Het
Rassf8 G A 6: 145,815,182 R78H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,450,201 Q3556R probably damaging Het
Rpa2 T C 4: 132,768,788 probably null Het
Rpe T G 1: 66,715,980 F174V possibly damaging Het
Sbf2 T C 7: 110,560,295 D36G probably damaging Het
Scn2a T A 2: 65,752,079 Y1590* probably null Het
Slc24a4 T C 12: 102,222,759 V151A probably damaging Het
Slc30a8 A T 15: 52,295,934 M17L probably benign Het
Slit3 T C 11: 35,688,679 Y1228H probably damaging Het
Smad4 G A 18: 73,662,744 T193M probably benign Het
Smtn T A 11: 3,530,045 H392L probably benign Het
St8sia3 A G 18: 64,269,674 D128G probably damaging Het
Sucla2 A T 14: 73,592,668 M382L possibly damaging Het
Tbx5 A G 5: 119,836,923 T4A probably benign Het
Tdrd5 T C 1: 156,276,573 R528G probably damaging Het
Tex44 T C 1: 86,427,089 L240P probably benign Het
Tns4 A T 11: 99,080,078 probably null Het
Trappc10 A T 10: 78,203,924 V731E possibly damaging Het
Ttf1 A G 2: 29,071,345 K582E probably damaging Het
Ttf2 C A 3: 100,948,193 Q895H possibly damaging Het
Ttll6 A G 11: 96,147,532 E402G probably damaging Het
Ttn A T 2: 76,890,092 probably null Het
Ugt8a T C 3: 125,875,546 D303G probably damaging Het
Ulk1 G T 5: 110,792,436 A373D probably benign Het
Vmn2r13 A G 5: 109,158,192 S507P probably benign Het
Vmn2r19 T A 6: 123,316,074 D358E possibly damaging Het
Vmn2r88 T C 14: 51,413,807 S201P probably benign Het
Zfp36l2 A G 17: 84,186,975 F78S probably damaging Het
Zfp454 A C 11: 50,873,995 S203R probably benign Het
Zfp616 C A 11: 74,085,403 Q833K probably benign Het
Znhit2 A G 19: 6,062,061 T279A probably benign Het
Zswim3 T A 2: 164,819,993 I131N probably benign Het
Other mutations in Alpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Alpk2 APN 18 65305823 missense probably benign 0.27
IGL00478:Alpk2 APN 18 65307226 nonsense probably null
IGL00898:Alpk2 APN 18 65350573 missense probably benign 0.29
IGL00978:Alpk2 APN 18 65291534 splice site probably benign
IGL01093:Alpk2 APN 18 65349329 missense probably damaging 0.98
IGL01094:Alpk2 APN 18 65306602 missense probably damaging 0.96
IGL01109:Alpk2 APN 18 65307140 missense probably benign 0.09
IGL01370:Alpk2 APN 18 65350591 missense possibly damaging 0.56
IGL01393:Alpk2 APN 18 65307708 missense possibly damaging 0.88
IGL01629:Alpk2 APN 18 65300042 missense probably damaging 1.00
IGL01872:Alpk2 APN 18 65304753 missense probably benign 0.01
IGL01983:Alpk2 APN 18 65350682 missense probably damaging 1.00
IGL02294:Alpk2 APN 18 65306075 missense possibly damaging 0.45
IGL02333:Alpk2 APN 18 65349480 missense probably damaging 0.99
IGL02493:Alpk2 APN 18 65350331 missense probably benign 0.02
IGL02551:Alpk2 APN 18 65372751 missense probably damaging 1.00
IGL02864:Alpk2 APN 18 65307599 missense probably benign 0.12
IGL02901:Alpk2 APN 18 65306411 missense probably benign
IGL02954:Alpk2 APN 18 65306136 missense probably benign
IGL03257:Alpk2 APN 18 65349874 missense probably damaging 0.99
IGL03389:Alpk2 APN 18 65304866 missense possibly damaging 0.92
3-1:Alpk2 UTSW 18 65304888 missense probably damaging 0.99
PIT4131001:Alpk2 UTSW 18 65306379 missense possibly damaging 0.84
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0414:Alpk2 UTSW 18 65306159 missense probably benign 0.04
R0546:Alpk2 UTSW 18 65306717 missense probably benign 0.05
R0628:Alpk2 UTSW 18 65307296 missense possibly damaging 0.94
R0658:Alpk2 UTSW 18 65349487 missense probably damaging 1.00
R0731:Alpk2 UTSW 18 65305390 missense probably damaging 0.98
R0919:Alpk2 UTSW 18 65307473 missense probably benign
R1069:Alpk2 UTSW 18 65305014 missense probably benign 0.25
R1186:Alpk2 UTSW 18 65294341 critical splice acceptor site probably null
R1508:Alpk2 UTSW 18 65349305 missense probably damaging 1.00
R1535:Alpk2 UTSW 18 65350204 missense probably benign
R1558:Alpk2 UTSW 18 65350230 missense probably benign
R1600:Alpk2 UTSW 18 65378037 missense probably damaging 0.96
R1664:Alpk2 UTSW 18 65349873 missense probably damaging 0.96
R1672:Alpk2 UTSW 18 65280959 missense probably damaging 1.00
R1829:Alpk2 UTSW 18 65294094 missense possibly damaging 0.75
R2110:Alpk2 UTSW 18 65307080 missense possibly damaging 0.94
R2111:Alpk2 UTSW 18 65349774 missense probably benign
R2113:Alpk2 UTSW 18 65305683 missense probably benign 0.31
R2198:Alpk2 UTSW 18 65350184 missense probably benign 0.42
R2227:Alpk2 UTSW 18 65378076 missense probably damaging 1.00
R2245:Alpk2 UTSW 18 65305163 missense probably benign 0.02
R2282:Alpk2 UTSW 18 65307626 missense probably benign
R2421:Alpk2 UTSW 18 65306616 missense probably benign 0.00
R2512:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R3105:Alpk2 UTSW 18 65350210 missense possibly damaging 0.57
R3700:Alpk2 UTSW 18 65305151 missense probably damaging 0.99
R4205:Alpk2 UTSW 18 65305211 missense possibly damaging 0.76
R4239:Alpk2 UTSW 18 65300141 missense probably damaging 1.00
R4353:Alpk2 UTSW 18 65291452 missense possibly damaging 0.73
R4572:Alpk2 UTSW 18 65281004 missense probably damaging 1.00
R4584:Alpk2 UTSW 18 65306964 missense probably damaging 0.99
R4591:Alpk2 UTSW 18 65305823 missense probably benign 0.27
R4595:Alpk2 UTSW 18 65289748 missense probably damaging 1.00
R4648:Alpk2 UTSW 18 65349882 missense probably damaging 0.99
R4815:Alpk2 UTSW 18 65349955 missense probably damaging 1.00
R4828:Alpk2 UTSW 18 65349113 missense probably benign
R4910:Alpk2 UTSW 18 65266286 nonsense probably null
R5042:Alpk2 UTSW 18 65350508 nonsense probably null
R5295:Alpk2 UTSW 18 65305038 missense probably damaging 0.98
R5375:Alpk2 UTSW 18 65372738 missense probably damaging 1.00
R5475:Alpk2 UTSW 18 65307012 missense probably benign 0.16
R5480:Alpk2 UTSW 18 65349908 missense probably damaging 1.00
R5486:Alpk2 UTSW 18 65294354 splice site probably null
R5503:Alpk2 UTSW 18 65306241 missense probably benign 0.00
R5595:Alpk2 UTSW 18 65266248 missense probably damaging 1.00
R5648:Alpk2 UTSW 18 65349917 missense probably damaging 0.96
R5714:Alpk2 UTSW 18 65305461 missense possibly damaging 0.55
R5862:Alpk2 UTSW 18 65307289 missense probably damaging 1.00
R5894:Alpk2 UTSW 18 65281072 missense probably damaging 0.99
R5898:Alpk2 UTSW 18 65307623 missense probably damaging 0.99
R5936:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R6142:Alpk2 UTSW 18 65305385 missense possibly damaging 0.94
R6291:Alpk2 UTSW 18 65305901 missense possibly damaging 0.93
R6339:Alpk2 UTSW 18 65349806 missense probably benign 0.00
R6407:Alpk2 UTSW 18 65289738 missense probably benign 0.22
R6487:Alpk2 UTSW 18 65266183 missense possibly damaging 0.62
R6667:Alpk2 UTSW 18 65307740 missense probably damaging 1.00
R6786:Alpk2 UTSW 18 65306634 missense probably benign
R6833:Alpk2 UTSW 18 65306409 missense probably benign 0.08
R6984:Alpk2 UTSW 18 65305678 missense possibly damaging 0.95
R6999:Alpk2 UTSW 18 65304513 missense probably damaging 0.99
R7157:Alpk2 UTSW 18 65266277 nonsense probably null
R7167:Alpk2 UTSW 18 65306978 missense probably benign 0.40
R7225:Alpk2 UTSW 18 65305199 missense probably benign 0.00
R7409:Alpk2 UTSW 18 65306952 missense probably benign 0.01
R7533:Alpk2 UTSW 18 65304603 missense probably damaging 1.00
R7576:Alpk2 UTSW 18 65306816 missense possibly damaging 0.89
R7589:Alpk2 UTSW 18 65300073 missense probably damaging 1.00
R7598:Alpk2 UTSW 18 65304566 missense probably damaging 1.00
R7664:Alpk2 UTSW 18 65307002 missense probably benign 0.03
R7711:Alpk2 UTSW 18 65306484 missense probably benign
R7722:Alpk2 UTSW 18 65350157 missense probably damaging 1.00
R7783:Alpk2 UTSW 18 65306254 nonsense probably null
R7806:Alpk2 UTSW 18 65349416 missense probably benign
R8024:Alpk2 UTSW 18 65305035 missense probably benign 0.01
R8043:Alpk2 UTSW 18 65349830 missense probably damaging 1.00
R8063:Alpk2 UTSW 18 65350346 missense probably benign 0.15
X0023:Alpk2 UTSW 18 65291400 missense probably damaging 1.00
X0027:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
X0063:Alpk2 UTSW 18 65307363 missense probably benign
X0064:Alpk2 UTSW 18 65349684 missense probably benign 0.09
Z1176:Alpk2 UTSW 18 65305611 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATGACTAGGGCTGACACTC -3'
(R):5'- GATCTGCTGTTCAGCATCCC -3'

Sequencing Primer
(F):5'- GACTAGGGCTGACACTCTCATTAG -3'
(R):5'- AGGTCTCTCCTGATCCTGGAG -3'
Posted On2014-09-17