Incidental Mutation 'R2086:Cenpb'
ID229970
Institutional Source Beutler Lab
Gene Symbol Cenpb
Ensembl Gene ENSMUSG00000068267
Gene Namecentromere protein B
Synonyms
MMRRC Submission 040091-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R2086 (G1)
Quality Score85
Status Validated
Chromosome2
Chromosomal Location131175182-131180067 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 131178597 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028801] [ENSMUST00000089510] [ENSMUST00000110218]
Predicted Effect probably benign
Transcript: ENSMUST00000028801
SMART Domains Protein: ENSMUSP00000028801
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH_2 13 109 9.3e-36 PFAM
Pfam:CAMSAP_CH 14 96 7.9e-24 PFAM
coiled coil region 182 234 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000089510
AA Change: E427G
SMART Domains Protein: ENSMUSP00000086938
Gene: ENSMUSG00000068267
AA Change: E427G

DomainStartEndE-ValueType
Pfam:CENP-B_N 2 56 1.6e-26 PFAM
CENPB 71 136 7.05e-23 SMART
low complexity region 140 158 N/A INTRINSIC
Pfam:DDE_1 222 384 4.9e-44 PFAM
coiled coil region 402 439 N/A INTRINSIC
Pfam:CENP-B_dimeris 499 598 5.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110218
SMART Domains Protein: ENSMUSP00000105847
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH 10 103 1.2e-7 PFAM
Pfam:DUF1042 13 164 5.7e-58 PFAM
Pfam:CAMSAP_CH 14 96 9e-23 PFAM
coiled coil region 182 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127987
SMART Domains Protein: ENSMUSP00000114178
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH_2 7 103 1.7e-36 PFAM
Pfam:CAMSAP_CH 8 90 6e-24 PFAM
Meta Mutation Damage Score 0.0892 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a highly conserved protein that facilitates centromere formation. It is a DNA-binding protein that is derived from transposases of the pogo DNA transposon family. It contains a helix-loop-helix DNA binding motif at the N-terminus, and a dimerization domain at the C-terminus. The DNA binding domain recognizes and binds a 17-bp sequence (CENP-B box) in the centromeric alpha satellite DNA. This protein is proposed to play an important role in the assembly of specific centromere structures in interphase nuclei and on mitotic chromosomes. It is also considered a major centromere autoantigen recognized by sera from patients with anti-centromere antibodies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display decreased body weight, small testis, oligospermia, and an age- and background-dependent reduction in female reproductive competence associated with abnormalities in uterus morphology, metral environment, gestational length, and parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik T C 7: 125,318,595 M53T unknown Het
Abcb11 T A 2: 69,259,476 probably benign Het
Acap2 C G 16: 31,110,945 A432P probably damaging Het
Adamtsl1 A G 4: 86,228,012 R302G probably damaging Het
Ap2b1 T G 11: 83,351,118 S608A possibly damaging Het
Atp13a3 T A 16: 30,352,298 T310S possibly damaging Het
Atp6v1b1 T C 6: 83,757,852 V382A probably benign Het
Atp6v1g1 T A 4: 63,550,067 F102L probably benign Het
B430306N03Rik T A 17: 48,316,782 V37D probably damaging Het
Cacna1d T C 14: 30,047,357 Y1872C possibly damaging Het
Carf T A 1: 60,109,411 Y54N probably damaging Het
Cct5 T C 15: 31,594,203 E256G probably damaging Het
Cd5 A G 19: 10,723,256 S295P probably benign Het
Cntnap3 A G 13: 64,794,262 M218T possibly damaging Het
Colec11 C T 12: 28,594,787 R236H probably damaging Het
Crem T A 18: 3,288,098 probably benign Het
Csnk2a1 A G 2: 152,254,281 N58S probably benign Het
Cyp2a4 T G 7: 26,312,308 M318R probably damaging Het
Dhrs1 T A 14: 55,743,659 Q98L probably null Het
Dnah11 G T 12: 118,113,871 Q1296K possibly damaging Het
Doxl2 A G 6: 48,977,602 E558G probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Eid2b C T 7: 28,277,773 probably benign Het
Exoc1 A T 5: 76,532,846 K28* probably null Het
Fam114a1 A G 5: 64,980,059 D115G probably benign Het
Fam151a A T 4: 106,735,563 probably null Het
Gc T C 5: 89,438,342 Y313C probably damaging Het
Gdpd1 A G 11: 87,035,268 Y284H probably benign Het
Gm21957 T A 7: 125,219,706 noncoding transcript Het
Golm1 G A 13: 59,645,185 Q169* probably null Het
Greb1l T C 18: 10,523,281 V813A probably damaging Het
Itih1 C T 14: 30,937,843 A279T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 T C 17: 67,817,623 C2893R probably damaging Het
Lama3 T A 18: 12,524,830 N334K probably benign Het
Loxhd1 A G 18: 77,384,946 D1053G probably damaging Het
Map3k20 A G 2: 72,398,385 K316R probably benign Het
Mapre3 A C 5: 30,863,202 probably null Het
Mfsd7a C T 5: 108,445,621 R117H probably damaging Het
Mgam T A 6: 40,761,028 probably null Het
Mical2 A C 7: 112,318,603 H389P probably benign Het
Mtmr2 A G 9: 13,799,952 D347G probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nodal A T 10: 61,423,298 E171D possibly damaging Het
Notch2 T C 3: 98,102,367 S537P probably damaging Het
Obox6 A G 7: 15,833,607 L305S probably damaging Het
Obscn T C 11: 59,078,256 D2715G probably damaging Het
Olfr154 A C 2: 85,663,746 S229R probably benign Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Pcca T C 14: 122,686,115 S404P probably damaging Het
Pcdh10 T C 3: 45,380,471 S407P probably damaging Het
Plekha5 C A 6: 140,570,318 probably null Het
Ptdss1 A G 13: 66,953,555 N72S probably benign Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Pygm G A 19: 6,391,481 probably null Het
Rab7 C T 6: 88,012,318 V57I probably benign Het
Rasl10a A G 11: 5,059,431 probably null Het
Rergl T C 6: 139,494,834 T106A probably benign Het
Rnf17 T G 14: 56,483,380 V1023G probably damaging Het
Rnf25 T A 1: 74,593,967 R409W probably damaging Het
Rps6ka1 T C 4: 133,872,969 M1V probably null Het
Rps6ka5 T C 12: 100,619,615 T140A possibly damaging Het
Sbno2 T A 10: 80,057,856 I1204F possibly damaging Het
Serpina16 A T 12: 103,675,262 I68N probably damaging Het
Slc35a5 A G 16: 45,144,265 S202P probably damaging Het
Slc35g3 G C 11: 69,760,946 S93W probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Spag1 T C 15: 36,227,141 L648P probably damaging Het
Tagap1 T C 17: 6,956,703 D198G probably benign Het
Tedc2 T C 17: 24,217,900 E287G probably damaging Het
Tjp1 C A 7: 65,312,921 R1089S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ttc38 T A 15: 85,838,727 D125E probably benign Het
Uggt1 C T 1: 36,192,414 R490Q probably null Het
Uroc1 T G 6: 90,344,114 L224R probably damaging Het
Vmn1r228 A T 17: 20,777,193 I21N possibly damaging Het
Vmn2r102 T G 17: 19,676,687 L99V probably damaging Het
Vps13c C T 9: 67,950,289 S2601F probably benign Het
Zfp462 T C 4: 55,010,830 L932P probably damaging Het
Other mutations in Cenpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02421:Cenpb APN 2 131179681 missense probably damaging 1.00
R0183:Cenpb UTSW 2 131178453 unclassified probably benign
R1378:Cenpb UTSW 2 131178310 unclassified probably benign
R1934:Cenpb UTSW 2 131179264 missense probably benign
R2132:Cenpb UTSW 2 131179306 missense probably damaging 1.00
R4776:Cenpb UTSW 2 131178183 unclassified probably benign
R5056:Cenpb UTSW 2 131178171 unclassified probably benign
R5120:Cenpb UTSW 2 131179818 missense probably benign 0.00
R5617:Cenpb UTSW 2 131179014 missense probably damaging 0.99
R6297:Cenpb UTSW 2 131178369 unclassified probably benign
R6467:Cenpb UTSW 2 131179557 missense probably damaging 1.00
R6673:Cenpb UTSW 2 131179245 missense probably damaging 0.98
R6916:Cenpb UTSW 2 131179624 missense probably benign 0.04
R7102:Cenpb UTSW 2 131178879 missense probably damaging 0.99
R7888:Cenpb UTSW 2 131179842 missense probably damaging 0.99
R7971:Cenpb UTSW 2 131179842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTCTTCCTGGACACTATAAC -3'
(R):5'- ATCCCTCAGGCTTGCAACTG -3'

Sequencing Primer
(F):5'- TTCCTGGACACTATAACCCCCAAAAC -3'
(R):5'- AGGCCCTGCACTTTGTG -3'
Posted On2014-09-18