Incidental Mutation 'R2086:Tjp1'
ID229996
Institutional Source Beutler Lab
Gene Symbol Tjp1
Ensembl Gene ENSMUSG00000030516
Gene Nametight junction protein 1
SynonymsZO1, ZO-1
MMRRC Submission 040091-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2086 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location65296165-65527781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65312921 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1089 (R1089S)
Ref Sequence ENSEMBL: ENSMUSP00000032729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032729] [ENSMUST00000102592] [ENSMUST00000206612]
Predicted Effect probably damaging
Transcript: ENSMUST00000032729
AA Change: R1089S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032729
Gene: ENSMUSG00000030516
AA Change: R1089S

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 1157 1176 N/A INTRINSIC
low complexity region 1246 1257 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1339 1365 N/A INTRINSIC
low complexity region 1389 1400 N/A INTRINSIC
ZU5 1549 1654 1.1e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102592
AA Change: R1169S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099652
Gene: ENSMUSG00000030516
AA Change: R1169S

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 939 955 N/A INTRINSIC
low complexity region 1237 1256 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1388 1399 N/A INTRINSIC
low complexity region 1419 1445 N/A INTRINSIC
low complexity region 1469 1480 N/A INTRINSIC
ZU5 1629 1735 1.84e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206612
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein located on a cytoplasmic membrane surface of intercellular tight junctions. The encoded protein may be involved in signal transduction at cell-cell junctions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality and growth retardation, failure of embryo turning and chorioallantoic fusion, defective yolk sac angiogenesis, and increased apoptosis in the notochord, neural tube, somite and allantois. Homozygotes for a reporter allele are overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik T C 7: 125,318,595 M53T unknown Het
Abcb11 T A 2: 69,259,476 probably benign Het
Acap2 C G 16: 31,110,945 A432P probably damaging Het
Adamtsl1 A G 4: 86,228,012 R302G probably damaging Het
Ap2b1 T G 11: 83,351,118 S608A possibly damaging Het
Atp13a3 T A 16: 30,352,298 T310S possibly damaging Het
Atp6v1b1 T C 6: 83,757,852 V382A probably benign Het
Atp6v1g1 T A 4: 63,550,067 F102L probably benign Het
B430306N03Rik T A 17: 48,316,782 V37D probably damaging Het
Cacna1d T C 14: 30,047,357 Y1872C possibly damaging Het
Carf T A 1: 60,109,411 Y54N probably damaging Het
Cct5 T C 15: 31,594,203 E256G probably damaging Het
Cd5 A G 19: 10,723,256 S295P probably benign Het
Cenpb T C 2: 131,178,597 probably benign Het
Cntnap3 A G 13: 64,794,262 M218T possibly damaging Het
Colec11 C T 12: 28,594,787 R236H probably damaging Het
Crem T A 18: 3,288,098 probably benign Het
Csnk2a1 A G 2: 152,254,281 N58S probably benign Het
Cyp2a4 T G 7: 26,312,308 M318R probably damaging Het
Dhrs1 T A 14: 55,743,659 Q98L probably null Het
Dnah11 G T 12: 118,113,871 Q1296K possibly damaging Het
Doxl2 A G 6: 48,977,602 E558G probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Eid2b C T 7: 28,277,773 probably benign Het
Exoc1 A T 5: 76,532,846 K28* probably null Het
Fam114a1 A G 5: 64,980,059 D115G probably benign Het
Fam151a A T 4: 106,735,563 probably null Het
Gc T C 5: 89,438,342 Y313C probably damaging Het
Gdpd1 A G 11: 87,035,268 Y284H probably benign Het
Gm21957 T A 7: 125,219,706 noncoding transcript Het
Golm1 G A 13: 59,645,185 Q169* probably null Het
Greb1l T C 18: 10,523,281 V813A probably damaging Het
Itih1 C T 14: 30,937,843 A279T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 T C 17: 67,817,623 C2893R probably damaging Het
Lama3 T A 18: 12,524,830 N334K probably benign Het
Loxhd1 A G 18: 77,384,946 D1053G probably damaging Het
Map3k20 A G 2: 72,398,385 K316R probably benign Het
Mapre3 A C 5: 30,863,202 probably null Het
Mfsd7a C T 5: 108,445,621 R117H probably damaging Het
Mgam T A 6: 40,761,028 probably null Het
Mical2 A C 7: 112,318,603 H389P probably benign Het
Mtmr2 A G 9: 13,799,952 D347G probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nodal A T 10: 61,423,298 E171D possibly damaging Het
Notch2 T C 3: 98,102,367 S537P probably damaging Het
Obox6 A G 7: 15,833,607 L305S probably damaging Het
Obscn T C 11: 59,078,256 D2715G probably damaging Het
Olfr154 A C 2: 85,663,746 S229R probably benign Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Pcca T C 14: 122,686,115 S404P probably damaging Het
Pcdh10 T C 3: 45,380,471 S407P probably damaging Het
Plekha5 C A 6: 140,570,318 probably null Het
Ptdss1 A G 13: 66,953,555 N72S probably benign Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Pygm G A 19: 6,391,481 probably null Het
Rab7 C T 6: 88,012,318 V57I probably benign Het
Rasl10a A G 11: 5,059,431 probably null Het
Rergl T C 6: 139,494,834 T106A probably benign Het
Rnf17 T G 14: 56,483,380 V1023G probably damaging Het
Rnf25 T A 1: 74,593,967 R409W probably damaging Het
Rps6ka1 T C 4: 133,872,969 M1V probably null Het
Rps6ka5 T C 12: 100,619,615 T140A possibly damaging Het
Sbno2 T A 10: 80,057,856 I1204F possibly damaging Het
Serpina16 A T 12: 103,675,262 I68N probably damaging Het
Slc35a5 A G 16: 45,144,265 S202P probably damaging Het
Slc35g3 G C 11: 69,760,946 S93W probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Spag1 T C 15: 36,227,141 L648P probably damaging Het
Tagap1 T C 17: 6,956,703 D198G probably benign Het
Tedc2 T C 17: 24,217,900 E287G probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ttc38 T A 15: 85,838,727 D125E probably benign Het
Uggt1 C T 1: 36,192,414 R490Q probably null Het
Uroc1 T G 6: 90,344,114 L224R probably damaging Het
Vmn1r228 A T 17: 20,777,193 I21N possibly damaging Het
Vmn2r102 T G 17: 19,676,687 L99V probably damaging Het
Vps13c C T 9: 67,950,289 S2601F probably benign Het
Zfp462 T C 4: 55,010,830 L932P probably damaging Het
Other mutations in Tjp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Tjp1 APN 7 65301219 missense probably benign
IGL00848:Tjp1 APN 7 65303194 missense probably benign 0.00
IGL01363:Tjp1 APN 7 65302965 missense possibly damaging 0.94
IGL01526:Tjp1 APN 7 65322658 missense probably damaging 1.00
IGL01607:Tjp1 APN 7 65336178 missense possibly damaging 0.94
IGL02223:Tjp1 APN 7 65322601 missense probably damaging 1.00
IGL02341:Tjp1 APN 7 65312634 missense probably damaging 1.00
IGL02347:Tjp1 APN 7 65301064 critical splice donor site probably null
IGL02452:Tjp1 APN 7 65312655 missense probably damaging 1.00
IGL02512:Tjp1 APN 7 65343667 missense probably damaging 1.00
IGL02552:Tjp1 APN 7 65299782 nonsense probably null
IGL02707:Tjp1 APN 7 65329683 nonsense probably null
IGL02707:Tjp1 APN 7 65329682 missense possibly damaging 0.85
IGL02939:Tjp1 APN 7 65314890 missense probably damaging 1.00
IGL03139:Tjp1 APN 7 65340434 splice site probably benign
IGL03273:Tjp1 APN 7 65299799 missense probably damaging 1.00
IGL03391:Tjp1 APN 7 65314969 missense probably damaging 1.00
PIT4453001:Tjp1 UTSW 7 65343614 critical splice donor site probably null
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0390:Tjp1 UTSW 7 65314990 missense probably damaging 1.00
R0519:Tjp1 UTSW 7 65302921 missense probably benign
R0653:Tjp1 UTSW 7 65314755 missense probably damaging 1.00
R1163:Tjp1 UTSW 7 65323054 missense probably damaging 1.00
R1544:Tjp1 UTSW 7 65302921 missense probably benign
R1634:Tjp1 UTSW 7 65302952 missense possibly damaging 0.94
R1767:Tjp1 UTSW 7 65312553 critical splice donor site probably null
R1771:Tjp1 UTSW 7 65313005 missense probably benign 0.45
R1794:Tjp1 UTSW 7 65323129 missense probably damaging 1.00
R1874:Tjp1 UTSW 7 65319253 missense probably damaging 1.00
R1971:Tjp1 UTSW 7 65324078 missense probably damaging 1.00
R1981:Tjp1 UTSW 7 65312855 missense probably damaging 0.99
R2310:Tjp1 UTSW 7 65329742 missense possibly damaging 0.90
R2942:Tjp1 UTSW 7 65318006 missense probably damaging 1.00
R3974:Tjp1 UTSW 7 65297639 nonsense probably null
R4295:Tjp1 UTSW 7 65323150 missense probably damaging 1.00
R4296:Tjp1 UTSW 7 65318489 missense probably damaging 1.00
R4567:Tjp1 UTSW 7 65306501 missense probably damaging 1.00
R4574:Tjp1 UTSW 7 65322605 missense probably damaging 1.00
R4910:Tjp1 UTSW 7 65343727 missense probably damaging 1.00
R4958:Tjp1 UTSW 7 65336102 nonsense probably null
R5267:Tjp1 UTSW 7 65323049 missense probably damaging 1.00
R5371:Tjp1 UTSW 7 65313311 nonsense probably null
R5422:Tjp1 UTSW 7 65302967 missense probably damaging 0.99
R5514:Tjp1 UTSW 7 65354861 missense probably damaging 1.00
R5652:Tjp1 UTSW 7 65312443 splice site probably null
R5693:Tjp1 UTSW 7 65342663 missense possibly damaging 0.96
R5933:Tjp1 UTSW 7 65302852 missense probably benign 0.29
R6043:Tjp1 UTSW 7 65324089 missense probably damaging 1.00
R6416:Tjp1 UTSW 7 65313205 missense possibly damaging 0.76
R6491:Tjp1 UTSW 7 65337117 missense possibly damaging 0.62
R6525:Tjp1 UTSW 7 65343651 missense probably damaging 1.00
R6658:Tjp1 UTSW 7 65301077 missense possibly damaging 0.82
R6917:Tjp1 UTSW 7 65299688 missense probably damaging 0.99
R6960:Tjp1 UTSW 7 65303015 missense possibly damaging 0.59
R7235:Tjp1 UTSW 7 65318573 missense probably benign 0.16
R7274:Tjp1 UTSW 7 65527652 missense possibly damaging 0.86
R7471:Tjp1 UTSW 7 65314690 missense probably damaging 0.99
R7475:Tjp1 UTSW 7 65322339 missense probably damaging 1.00
R7479:Tjp1 UTSW 7 65301180 missense probably damaging 0.98
X0022:Tjp1 UTSW 7 65302841 missense possibly damaging 0.75
X0027:Tjp1 UTSW 7 65314759 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TCCTCCTCAGTTAGGGTTGG -3'
(R):5'- TTGAGAATCAGCATCCCCGAG -3'

Sequencing Primer
(F):5'- CTTTTGTTGAGAGGAAGGTATCAGAG -3'
(R):5'- ATCCCCGAGACCTGGACTC -3'
Posted On2014-09-18