Incidental Mutation 'R2086:Tnrc6a'
ID229998
Institutional Source Beutler Lab
Gene Symbol Tnrc6a
Ensembl Gene ENSMUSG00000052707
Gene Nametrinucleotide repeat containing 6a
SynonymsCAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik
MMRRC Submission 040091-MU
Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene? Probably essential (E-score: 0.868) question?
Stock #R2086 (G1)
Quality Score120
Status Validated
Chromosome7
Chromosomal Location123123885-123195296 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT to CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT at 123162446 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206888]
Predicted Effect probably benign
Transcript: ENSMUST00000094053
SMART Domains Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707

DomainStartEndE-ValueType
coiled coil region 5 54 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
low complexity region 430 443 N/A INTRINSIC
low complexity region 568 590 N/A INTRINSIC
internal_repeat_1 690 853 3.51e-6 PROSPERO
low complexity region 858 871 N/A INTRINSIC
Pfam:Ago_hook 1028 1190 1.2e-29 PFAM
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1301 1316 N/A INTRINSIC
low complexity region 1337 1376 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1439 1714 1.5e-126 PFAM
RRM 1717 1784 4.95e-2 SMART
low complexity region 1808 1820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206458
Predicted Effect probably benign
Transcript: ENSMUST00000206888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211170
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik T C 7: 125,318,595 M53T unknown Het
Abcb11 T A 2: 69,259,476 probably benign Het
Acap2 C G 16: 31,110,945 A432P probably damaging Het
Adamtsl1 A G 4: 86,228,012 R302G probably damaging Het
Ap2b1 T G 11: 83,351,118 S608A possibly damaging Het
Atp13a3 T A 16: 30,352,298 T310S possibly damaging Het
Atp6v1b1 T C 6: 83,757,852 V382A probably benign Het
Atp6v1g1 T A 4: 63,550,067 F102L probably benign Het
B430306N03Rik T A 17: 48,316,782 V37D probably damaging Het
Cacna1d T C 14: 30,047,357 Y1872C possibly damaging Het
Carf T A 1: 60,109,411 Y54N probably damaging Het
Cct5 T C 15: 31,594,203 E256G probably damaging Het
Cd5 A G 19: 10,723,256 S295P probably benign Het
Cenpb T C 2: 131,178,597 probably benign Het
Cntnap3 A G 13: 64,794,262 M218T possibly damaging Het
Colec11 C T 12: 28,594,787 R236H probably damaging Het
Crem T A 18: 3,288,098 probably benign Het
Csnk2a1 A G 2: 152,254,281 N58S probably benign Het
Cyp2a4 T G 7: 26,312,308 M318R probably damaging Het
Dhrs1 T A 14: 55,743,659 Q98L probably null Het
Dnah11 G T 12: 118,113,871 Q1296K possibly damaging Het
Doxl2 A G 6: 48,977,602 E558G probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Eid2b C T 7: 28,277,773 probably benign Het
Exoc1 A T 5: 76,532,846 K28* probably null Het
Fam114a1 A G 5: 64,980,059 D115G probably benign Het
Fam151a A T 4: 106,735,563 probably null Het
Gc T C 5: 89,438,342 Y313C probably damaging Het
Gdpd1 A G 11: 87,035,268 Y284H probably benign Het
Gm21957 T A 7: 125,219,706 noncoding transcript Het
Golm1 G A 13: 59,645,185 Q169* probably null Het
Greb1l T C 18: 10,523,281 V813A probably damaging Het
Itih1 C T 14: 30,937,843 A279T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 T C 17: 67,817,623 C2893R probably damaging Het
Lama3 T A 18: 12,524,830 N334K probably benign Het
Loxhd1 A G 18: 77,384,946 D1053G probably damaging Het
Map3k20 A G 2: 72,398,385 K316R probably benign Het
Mapre3 A C 5: 30,863,202 probably null Het
Mfsd7a C T 5: 108,445,621 R117H probably damaging Het
Mgam T A 6: 40,761,028 probably null Het
Mical2 A C 7: 112,318,603 H389P probably benign Het
Mtmr2 A G 9: 13,799,952 D347G probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nodal A T 10: 61,423,298 E171D possibly damaging Het
Notch2 T C 3: 98,102,367 S537P probably damaging Het
Obox6 A G 7: 15,833,607 L305S probably damaging Het
Obscn T C 11: 59,078,256 D2715G probably damaging Het
Olfr154 A C 2: 85,663,746 S229R probably benign Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Pcca T C 14: 122,686,115 S404P probably damaging Het
Pcdh10 T C 3: 45,380,471 S407P probably damaging Het
Plekha5 C A 6: 140,570,318 probably null Het
Ptdss1 A G 13: 66,953,555 N72S probably benign Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Pygm G A 19: 6,391,481 probably null Het
Rab7 C T 6: 88,012,318 V57I probably benign Het
Rasl10a A G 11: 5,059,431 probably null Het
Rergl T C 6: 139,494,834 T106A probably benign Het
Rnf17 T G 14: 56,483,380 V1023G probably damaging Het
Rnf25 T A 1: 74,593,967 R409W probably damaging Het
Rps6ka1 T C 4: 133,872,969 M1V probably null Het
Rps6ka5 T C 12: 100,619,615 T140A possibly damaging Het
Sbno2 T A 10: 80,057,856 I1204F possibly damaging Het
Serpina16 A T 12: 103,675,262 I68N probably damaging Het
Slc35a5 A G 16: 45,144,265 S202P probably damaging Het
Slc35g3 G C 11: 69,760,946 S93W probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Spag1 T C 15: 36,227,141 L648P probably damaging Het
Tagap1 T C 17: 6,956,703 D198G probably benign Het
Tedc2 T C 17: 24,217,900 E287G probably damaging Het
Tjp1 C A 7: 65,312,921 R1089S probably damaging Het
Ttc38 T A 15: 85,838,727 D125E probably benign Het
Uggt1 C T 1: 36,192,414 R490Q probably null Het
Uroc1 T G 6: 90,344,114 L224R probably damaging Het
Vmn1r228 A T 17: 20,777,193 I21N possibly damaging Het
Vmn2r102 T G 17: 19,676,687 L99V probably damaging Het
Vps13c C T 9: 67,950,289 S2601F probably benign Het
Zfp462 T C 4: 55,010,830 L932P probably damaging Het
Other mutations in Tnrc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Tnrc6a APN 7 123170780 missense probably benign 0.04
IGL00580:Tnrc6a APN 7 123174278 missense probably damaging 1.00
IGL01309:Tnrc6a APN 7 123171494 missense probably benign 0.04
IGL02004:Tnrc6a APN 7 123181366 missense possibly damaging 0.57
IGL02142:Tnrc6a APN 7 123152191 intron probably benign
IGL02220:Tnrc6a APN 7 123170456 missense probably benign
IGL02436:Tnrc6a APN 7 123184215 nonsense probably null
IGL02670:Tnrc6a APN 7 123171312 missense possibly damaging 0.92
IGL02743:Tnrc6a APN 7 123171473 missense probably damaging 1.00
0152:Tnrc6a UTSW 7 123180654 missense probably damaging 1.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0369:Tnrc6a UTSW 7 123170860 missense probably damaging 1.00
R0512:Tnrc6a UTSW 7 123186728 splice site probably benign
R0566:Tnrc6a UTSW 7 123170913 missense probably benign 0.00
R0600:Tnrc6a UTSW 7 123171816 missense probably benign 0.14
R0751:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1184:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1319:Tnrc6a UTSW 7 123184251 missense probably benign 0.02
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1585:Tnrc6a UTSW 7 123176875 missense probably benign 0.08
R1709:Tnrc6a UTSW 7 123169982 missense probably benign 0.10
R1776:Tnrc6a UTSW 7 123171297 missense probably damaging 1.00
R1791:Tnrc6a UTSW 7 123192917 missense possibly damaging 0.47
R1807:Tnrc6a UTSW 7 123162446 splice site probably benign
R1876:Tnrc6a UTSW 7 123162446 splice site probably benign
R2010:Tnrc6a UTSW 7 123171046 missense probably benign 0.26
R2089:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2511:Tnrc6a UTSW 7 123171092 missense probably damaging 1.00
R2830:Tnrc6a UTSW 7 123192949 makesense probably null
R2850:Tnrc6a UTSW 7 123179800 missense probably damaging 1.00
R3916:Tnrc6a UTSW 7 123181384 missense probably damaging 1.00
R4028:Tnrc6a UTSW 7 123170121 missense probably damaging 1.00
R4235:Tnrc6a UTSW 7 123171680 missense probably benign 0.00
R4439:Tnrc6a UTSW 7 123152182 nonsense probably null
R4525:Tnrc6a UTSW 7 123179782 missense probably benign
R4578:Tnrc6a UTSW 7 123184221 missense possibly damaging 0.89
R4613:Tnrc6a UTSW 7 123184289 critical splice donor site probably null
R4711:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R4722:Tnrc6a UTSW 7 123192090 missense possibly damaging 0.78
R4746:Tnrc6a UTSW 7 123189997 missense probably damaging 1.00
R4892:Tnrc6a UTSW 7 123169911 missense probably damaging 1.00
R4942:Tnrc6a UTSW 7 123192613 missense probably damaging 0.99
R4967:Tnrc6a UTSW 7 123189872 missense probably damaging 1.00
R5064:Tnrc6a UTSW 7 123186723 critical splice donor site probably null
R5239:Tnrc6a UTSW 7 123186619 missense probably benign
R5604:Tnrc6a UTSW 7 123174236 missense probably damaging 0.97
R5805:Tnrc6a UTSW 7 123170076 missense probably damaging 0.97
R5942:Tnrc6a UTSW 7 123186665 missense probably damaging 1.00
R5988:Tnrc6a UTSW 7 123182380 missense probably damaging 0.96
R6212:Tnrc6a UTSW 7 123143742 splice site probably null
R6284:Tnrc6a UTSW 7 123171335 missense probably damaging 0.99
R6417:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6420:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6575:Tnrc6a UTSW 7 123169910 missense probably damaging 1.00
R6760:Tnrc6a UTSW 7 123171999 missense probably damaging 1.00
R6886:Tnrc6a UTSW 7 123187445 missense probably benign 0.17
R6968:Tnrc6a UTSW 7 123182427 missense probably benign 0.05
R7216:Tnrc6a UTSW 7 123171495 missense probably benign 0.01
R7260:Tnrc6a UTSW 7 123186590 missense probably benign 0.36
R7299:Tnrc6a UTSW 7 123170913 missense probably benign
R7322:Tnrc6a UTSW 7 123171508 missense probably benign 0.09
R7872:Tnrc6a UTSW 7 123179834 missense probably damaging 0.99
R7955:Tnrc6a UTSW 7 123179834 missense probably damaging 0.99
X0064:Tnrc6a UTSW 7 123169798 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ATGACCATGAGCGTCATCCTG -3'
(R):5'- ACTTCACGTGGATACCGAGG -3'

Sequencing Primer
(F):5'- CACCATTGTGGATACTTTAGTAGC -3'
(R):5'- TACCGAGGCAAGGCTTGTG -3'
Posted On2014-09-18