Incidental Mutation 'R2086:Edc4'
ID230001
Institutional Source Beutler Lab
Gene Symbol Edc4
Ensembl Gene ENSMUSG00000036270
Gene Nameenhancer of mRNA decapping 4
Synonyms
MMRRC Submission 040091-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2086 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105880881-105894908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105888002 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 105 (D105E)
Ref Sequence ENSEMBL: ENSMUSP00000118162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040254] [ENSMUST00000119261] [ENSMUST00000136048] [ENSMUST00000145618]
Predicted Effect probably benign
Transcript: ENSMUST00000040254
AA Change: D530E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000039134
Gene: ENSMUSG00000036270
AA Change: D530E

DomainStartEndE-ValueType
Blast:WD40 33 93 1e-7 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
WD40 333 384 2.3e0 SMART
low complexity region 609 644 N/A INTRINSIC
low complexity region 664 692 N/A INTRINSIC
low complexity region 773 785 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
coiled coil region 1001 1030 N/A INTRINSIC
low complexity region 1267 1285 N/A INTRINSIC
PDB:2VXG|B 1286 1402 3e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000119261
AA Change: D530E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000113854
Gene: ENSMUSG00000036270
AA Change: D530E

DomainStartEndE-ValueType
Blast:WD40 33 93 1e-7 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
WD40 333 384 2.3e0 SMART
low complexity region 609 644 N/A INTRINSIC
low complexity region 664 692 N/A INTRINSIC
low complexity region 773 785 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
coiled coil region 985 1014 N/A INTRINSIC
low complexity region 1251 1269 N/A INTRINSIC
PDB:2VXG|B 1270 1386 3e-18 PDB
Predicted Effect
SMART Domains Protein: ENSMUSP00000114209
Gene: ENSMUSG00000036270
AA Change: D109E

DomainStartEndE-ValueType
low complexity region 189 224 N/A INTRINSIC
low complexity region 245 273 N/A INTRINSIC
low complexity region 354 366 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136048
AA Change: D470E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000114285
Gene: ENSMUSG00000036270
AA Change: D470E

DomainStartEndE-ValueType
Blast:WD40 33 93 9e-8 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
low complexity region 549 584 N/A INTRINSIC
low complexity region 604 632 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
low complexity region 961 990 N/A INTRINSIC
low complexity region 1215 1233 N/A INTRINSIC
PDB:2VXG|B 1234 1317 1e-14 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139154
Predicted Effect probably damaging
Transcript: ENSMUST00000145618
AA Change: D105E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118162
Gene: ENSMUSG00000036270
AA Change: D105E

DomainStartEndE-ValueType
low complexity region 185 220 N/A INTRINSIC
low complexity region 240 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156357
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: The protein encoded by this gene is thought to promote mRNA decay, and is known to interact with several mRNA decapping proteins. In humans, decreased expression of this gene prevents the accumulation of mRNA decapping proteins to mRNA processing bodies (P-body). Alternative splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik T C 7: 125,318,595 M53T unknown Het
Abcb11 T A 2: 69,259,476 probably benign Het
Acap2 C G 16: 31,110,945 A432P probably damaging Het
Adamtsl1 A G 4: 86,228,012 R302G probably damaging Het
Ap2b1 T G 11: 83,351,118 S608A possibly damaging Het
Atp13a3 T A 16: 30,352,298 T310S possibly damaging Het
Atp6v1b1 T C 6: 83,757,852 V382A probably benign Het
Atp6v1g1 T A 4: 63,550,067 F102L probably benign Het
B430306N03Rik T A 17: 48,316,782 V37D probably damaging Het
Cacna1d T C 14: 30,047,357 Y1872C possibly damaging Het
Carf T A 1: 60,109,411 Y54N probably damaging Het
Cct5 T C 15: 31,594,203 E256G probably damaging Het
Cd5 A G 19: 10,723,256 S295P probably benign Het
Cenpb T C 2: 131,178,597 probably benign Het
Cntnap3 A G 13: 64,794,262 M218T possibly damaging Het
Colec11 C T 12: 28,594,787 R236H probably damaging Het
Crem T A 18: 3,288,098 probably benign Het
Csnk2a1 A G 2: 152,254,281 N58S probably benign Het
Cyp2a4 T G 7: 26,312,308 M318R probably damaging Het
Dhrs1 T A 14: 55,743,659 Q98L probably null Het
Dnah11 G T 12: 118,113,871 Q1296K possibly damaging Het
Doxl2 A G 6: 48,977,602 E558G probably damaging Het
Eid2b C T 7: 28,277,773 probably benign Het
Exoc1 A T 5: 76,532,846 K28* probably null Het
Fam114a1 A G 5: 64,980,059 D115G probably benign Het
Fam151a A T 4: 106,735,563 probably null Het
Gc T C 5: 89,438,342 Y313C probably damaging Het
Gdpd1 A G 11: 87,035,268 Y284H probably benign Het
Gm21957 T A 7: 125,219,706 noncoding transcript Het
Golm1 G A 13: 59,645,185 Q169* probably null Het
Greb1l T C 18: 10,523,281 V813A probably damaging Het
Itih1 C T 14: 30,937,843 A279T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 T C 17: 67,817,623 C2893R probably damaging Het
Lama3 T A 18: 12,524,830 N334K probably benign Het
Loxhd1 A G 18: 77,384,946 D1053G probably damaging Het
Map3k20 A G 2: 72,398,385 K316R probably benign Het
Mapre3 A C 5: 30,863,202 probably null Het
Mfsd7a C T 5: 108,445,621 R117H probably damaging Het
Mgam T A 6: 40,761,028 probably null Het
Mical2 A C 7: 112,318,603 H389P probably benign Het
Mtmr2 A G 9: 13,799,952 D347G probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nodal A T 10: 61,423,298 E171D possibly damaging Het
Notch2 T C 3: 98,102,367 S537P probably damaging Het
Obox6 A G 7: 15,833,607 L305S probably damaging Het
Obscn T C 11: 59,078,256 D2715G probably damaging Het
Olfr154 A C 2: 85,663,746 S229R probably benign Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Pcca T C 14: 122,686,115 S404P probably damaging Het
Pcdh10 T C 3: 45,380,471 S407P probably damaging Het
Plekha5 C A 6: 140,570,318 probably null Het
Ptdss1 A G 13: 66,953,555 N72S probably benign Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Pygm G A 19: 6,391,481 probably null Het
Rab7 C T 6: 88,012,318 V57I probably benign Het
Rasl10a A G 11: 5,059,431 probably null Het
Rergl T C 6: 139,494,834 T106A probably benign Het
Rnf17 T G 14: 56,483,380 V1023G probably damaging Het
Rnf25 T A 1: 74,593,967 R409W probably damaging Het
Rps6ka1 T C 4: 133,872,969 M1V probably null Het
Rps6ka5 T C 12: 100,619,615 T140A possibly damaging Het
Sbno2 T A 10: 80,057,856 I1204F possibly damaging Het
Serpina16 A T 12: 103,675,262 I68N probably damaging Het
Slc35a5 A G 16: 45,144,265 S202P probably damaging Het
Slc35g3 G C 11: 69,760,946 S93W probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Spag1 T C 15: 36,227,141 L648P probably damaging Het
Tagap1 T C 17: 6,956,703 D198G probably benign Het
Tedc2 T C 17: 24,217,900 E287G probably damaging Het
Tjp1 C A 7: 65,312,921 R1089S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ttc38 T A 15: 85,838,727 D125E probably benign Het
Uggt1 C T 1: 36,192,414 R490Q probably null Het
Uroc1 T G 6: 90,344,114 L224R probably damaging Het
Vmn1r228 A T 17: 20,777,193 I21N possibly damaging Het
Vmn2r102 T G 17: 19,676,687 L99V probably damaging Het
Vps13c C T 9: 67,950,289 S2601F probably benign Het
Zfp462 T C 4: 55,010,830 L932P probably damaging Het
Other mutations in Edc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Edc4 APN 8 105881123 missense probably damaging 1.00
IGL01069:Edc4 APN 8 105887134 missense probably benign 0.35
IGL01470:Edc4 APN 8 105889981 unclassified probably benign
IGL01656:Edc4 APN 8 105886377 missense possibly damaging 0.55
IGL01804:Edc4 APN 8 105890657 missense possibly damaging 0.92
IGL02135:Edc4 APN 8 105885822 missense probably damaging 1.00
IGL02825:Edc4 APN 8 105890611 missense probably damaging 1.00
IGL03036:Edc4 APN 8 105887311 unclassified probably null
IGL03401:Edc4 APN 8 105887514 nonsense probably null
IGL03409:Edc4 APN 8 105885116 missense probably damaging 1.00
Armor UTSW 8 105890867 missense probably damaging 1.00
mail UTSW 8 105886309 splice site probably null
R0362:Edc4 UTSW 8 105886775 missense probably damaging 1.00
R0541:Edc4 UTSW 8 105889428 missense probably benign 0.00
R0614:Edc4 UTSW 8 105889396 missense possibly damaging 0.93
R0631:Edc4 UTSW 8 105890792 missense possibly damaging 0.57
R1067:Edc4 UTSW 8 105891005 missense probably damaging 0.97
R1270:Edc4 UTSW 8 105891264 missense possibly damaging 0.90
R1371:Edc4 UTSW 8 105890750 unclassified probably benign
R1384:Edc4 UTSW 8 105892382 missense probably damaging 1.00
R1417:Edc4 UTSW 8 105887855 critical splice donor site probably null
R1423:Edc4 UTSW 8 105891211 unclassified probably benign
R1446:Edc4 UTSW 8 105888132 missense probably damaging 0.96
R1472:Edc4 UTSW 8 105892828 missense probably damaging 0.99
R1797:Edc4 UTSW 8 105891085 missense probably benign 0.03
R2092:Edc4 UTSW 8 105887528 missense probably damaging 1.00
R3079:Edc4 UTSW 8 105885118 missense possibly damaging 0.86
R3551:Edc4 UTSW 8 105885494 missense probably damaging 1.00
R4492:Edc4 UTSW 8 105885068 frame shift probably null
R4650:Edc4 UTSW 8 105892675 nonsense probably null
R4735:Edc4 UTSW 8 105887186 missense probably damaging 1.00
R4854:Edc4 UTSW 8 105887925 intron probably benign
R5530:Edc4 UTSW 8 105889254 nonsense probably null
R5851:Edc4 UTSW 8 105890867 missense probably damaging 1.00
R5889:Edc4 UTSW 8 105888022 missense possibly damaging 0.87
R5903:Edc4 UTSW 8 105890587 missense probably benign 0.04
R5996:Edc4 UTSW 8 105887401 missense probably damaging 1.00
R6078:Edc4 UTSW 8 105887548 missense probably benign 0.01
R6079:Edc4 UTSW 8 105887548 missense probably benign 0.01
R6143:Edc4 UTSW 8 105885874 missense probably damaging 1.00
R7072:Edc4 UTSW 8 105888002 missense probably damaging 1.00
R7211:Edc4 UTSW 8 105886309 splice site probably null
R7368:Edc4 UTSW 8 105888405 small deletion probably benign
R7429:Edc4 UTSW 8 105891584 missense probably damaging 1.00
R7430:Edc4 UTSW 8 105891584 missense probably damaging 1.00
R7787:Edc4 UTSW 8 105887514 nonsense probably null
RF009:Edc4 UTSW 8 105889180 missense probably benign 0.27
RF014:Edc4 UTSW 8 105884600 missense probably benign
U15987:Edc4 UTSW 8 105887548 missense probably benign 0.01
X0018:Edc4 UTSW 8 105887001 missense probably damaging 1.00
X0063:Edc4 UTSW 8 105884580 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCAGAGAGTTCCCATGGAGC -3'
(R):5'- GAACCATGAGCAGCTGAAGC -3'

Sequencing Primer
(F):5'- AGCTGGAGCCTTGGAATCC -3'
(R):5'- TGAAGCTAGCCCCTCGGAG -3'
Posted On2014-09-18