Incidental Mutation 'R2086:Rasl10a'
ID230007
Institutional Source Beutler Lab
Gene Symbol Rasl10a
Ensembl Gene ENSMUSG00000034209
Gene NameRAS-like, family 10, member A
Synonyms
MMRRC Submission 040091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2086 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5058128-5060385 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 5059431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037146] [ENSMUST00000037218] [ENSMUST00000056649] [ENSMUST00000109895] [ENSMUST00000152257]
Predicted Effect probably benign
Transcript: ENSMUST00000037146
SMART Domains Protein: ENSMUSP00000043709
Gene: ENSMUSG00000034201

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000037218
SMART Domains Protein: ENSMUSP00000048453
Gene: ENSMUSG00000034209

DomainStartEndE-ValueType
Pfam:Ras 6 180 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056649
SMART Domains Protein: ENSMUSP00000050275
Gene: ENSMUSG00000034201

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 335 365 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 460 473 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 509 539 N/A INTRINSIC
low complexity region 546 568 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109895
SMART Domains Protein: ENSMUSP00000105521
Gene: ENSMUSG00000034201

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 335 365 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 460 473 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 509 539 N/A INTRINSIC
low complexity region 546 568 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151936
Predicted Effect probably benign
Transcript: ENSMUST00000152257
SMART Domains Protein: ENSMUSP00000121993
Gene: ENSMUSG00000034201

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156196
Meta Mutation Damage Score 0.9501 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik T C 7: 125,318,595 M53T unknown Het
Abcb11 T A 2: 69,259,476 probably benign Het
Acap2 C G 16: 31,110,945 A432P probably damaging Het
Adamtsl1 A G 4: 86,228,012 R302G probably damaging Het
Ap2b1 T G 11: 83,351,118 S608A possibly damaging Het
Atp13a3 T A 16: 30,352,298 T310S possibly damaging Het
Atp6v1b1 T C 6: 83,757,852 V382A probably benign Het
Atp6v1g1 T A 4: 63,550,067 F102L probably benign Het
B430306N03Rik T A 17: 48,316,782 V37D probably damaging Het
Cacna1d T C 14: 30,047,357 Y1872C possibly damaging Het
Carf T A 1: 60,109,411 Y54N probably damaging Het
Cct5 T C 15: 31,594,203 E256G probably damaging Het
Cd5 A G 19: 10,723,256 S295P probably benign Het
Cenpb T C 2: 131,178,597 probably benign Het
Cntnap3 A G 13: 64,794,262 M218T possibly damaging Het
Colec11 C T 12: 28,594,787 R236H probably damaging Het
Crem T A 18: 3,288,098 probably benign Het
Csnk2a1 A G 2: 152,254,281 N58S probably benign Het
Cyp2a4 T G 7: 26,312,308 M318R probably damaging Het
Dhrs1 T A 14: 55,743,659 Q98L probably null Het
Dnah11 G T 12: 118,113,871 Q1296K possibly damaging Het
Doxl2 A G 6: 48,977,602 E558G probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Eid2b C T 7: 28,277,773 probably benign Het
Exoc1 A T 5: 76,532,846 K28* probably null Het
Fam114a1 A G 5: 64,980,059 D115G probably benign Het
Fam151a A T 4: 106,735,563 probably null Het
Gc T C 5: 89,438,342 Y313C probably damaging Het
Gdpd1 A G 11: 87,035,268 Y284H probably benign Het
Gm21957 T A 7: 125,219,706 noncoding transcript Het
Golm1 G A 13: 59,645,185 Q169* probably null Het
Greb1l T C 18: 10,523,281 V813A probably damaging Het
Itih1 C T 14: 30,937,843 A279T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 T C 17: 67,817,623 C2893R probably damaging Het
Lama3 T A 18: 12,524,830 N334K probably benign Het
Loxhd1 A G 18: 77,384,946 D1053G probably damaging Het
Map3k20 A G 2: 72,398,385 K316R probably benign Het
Mapre3 A C 5: 30,863,202 probably null Het
Mfsd7a C T 5: 108,445,621 R117H probably damaging Het
Mgam T A 6: 40,761,028 probably null Het
Mical2 A C 7: 112,318,603 H389P probably benign Het
Mtmr2 A G 9: 13,799,952 D347G probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nodal A T 10: 61,423,298 E171D possibly damaging Het
Notch2 T C 3: 98,102,367 S537P probably damaging Het
Obox6 A G 7: 15,833,607 L305S probably damaging Het
Obscn T C 11: 59,078,256 D2715G probably damaging Het
Olfr154 A C 2: 85,663,746 S229R probably benign Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Pcca T C 14: 122,686,115 S404P probably damaging Het
Pcdh10 T C 3: 45,380,471 S407P probably damaging Het
Plekha5 C A 6: 140,570,318 probably null Het
Ptdss1 A G 13: 66,953,555 N72S probably benign Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Pygm G A 19: 6,391,481 probably null Het
Rab7 C T 6: 88,012,318 V57I probably benign Het
Rergl T C 6: 139,494,834 T106A probably benign Het
Rnf17 T G 14: 56,483,380 V1023G probably damaging Het
Rnf25 T A 1: 74,593,967 R409W probably damaging Het
Rps6ka1 T C 4: 133,872,969 M1V probably null Het
Rps6ka5 T C 12: 100,619,615 T140A possibly damaging Het
Sbno2 T A 10: 80,057,856 I1204F possibly damaging Het
Serpina16 A T 12: 103,675,262 I68N probably damaging Het
Slc35a5 A G 16: 45,144,265 S202P probably damaging Het
Slc35g3 G C 11: 69,760,946 S93W probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Spag1 T C 15: 36,227,141 L648P probably damaging Het
Tagap1 T C 17: 6,956,703 D198G probably benign Het
Tedc2 T C 17: 24,217,900 E287G probably damaging Het
Tjp1 C A 7: 65,312,921 R1089S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ttc38 T A 15: 85,838,727 D125E probably benign Het
Uggt1 C T 1: 36,192,414 R490Q probably null Het
Uroc1 T G 6: 90,344,114 L224R probably damaging Het
Vmn1r228 A T 17: 20,777,193 I21N possibly damaging Het
Vmn2r102 T G 17: 19,676,687 L99V probably damaging Het
Vps13c C T 9: 67,950,289 S2601F probably benign Het
Zfp462 T C 4: 55,010,830 L932P probably damaging Het
Other mutations in Rasl10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02233:Rasl10a APN 11 5058333 missense probably damaging 0.99
IGL03149:Rasl10a APN 11 5058429 missense possibly damaging 0.80
R1630:Rasl10a UTSW 11 5059542 missense probably damaging 0.99
R1678:Rasl10a UTSW 11 5059815 missense possibly damaging 0.61
R1925:Rasl10a UTSW 11 5059473 missense possibly damaging 0.84
R3792:Rasl10a UTSW 11 5059461 missense probably damaging 0.99
R4482:Rasl10a UTSW 11 5058429 missense probably damaging 1.00
R4719:Rasl10a UTSW 11 5058517 missense probably benign 0.03
R5743:Rasl10a UTSW 11 5059519 missense probably benign 0.02
R6168:Rasl10a UTSW 11 5058442 missense possibly damaging 0.76
R6530:Rasl10a UTSW 11 5058367 missense probably damaging 1.00
R6684:Rasl10a UTSW 11 5058396 missense possibly damaging 0.49
R8049:Rasl10a UTSW 11 5059823 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCTGAGGCAGTAGGAGCATAG -3'
(R):5'- ACCTTCAAGTGGGCACAAAG -3'

Sequencing Primer
(F):5'- CATAGTAGGTTGACGGGTGGCC -3'
(R):5'- CCTTCAAGTGGGCACAAAGTATGATC -3'
Posted On2014-09-18