Incidental Mutation 'R2086:Ap2b1'
ID230010
Institutional Source Beutler Lab
Gene Symbol Ap2b1
Ensembl Gene ENSMUSG00000035152
Gene Nameadaptor-related protein complex 2, beta 1 subunit
Synonyms1300012O03Rik
MMRRC Submission 040091-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2086 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83299024-83405035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 83351118 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 608 (S608A)
Ref Sequence ENSEMBL: ENSMUSP00000135445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]
Predicted Effect probably benign
Transcript: ENSMUST00000018875
AA Change: S646A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: S646A

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 2.6e-173 PFAM
Pfam:HEAT_2 88 157 3.7e-8 PFAM
Pfam:Cnd1 99 268 2.1e-40 PFAM
Pfam:HEAT_2 124 219 1.4e-9 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 950 9.93e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065692
AA Change: S646A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: S646A

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4.2e-173 PFAM
Pfam:HEAT_2 88 157 2.7e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Alpha_adaptinC2 707 817 2.94e-18 SMART
B2-adapt-app_C 826 936 9.93e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176430
AA Change: S646A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: S646A

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4e-173 PFAM
Pfam:HEAT_2 88 157 2.8e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 936 7.22e-35 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176523
AA Change: S608A

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: S608A

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 95 1.1e-26 PFAM
Pfam:Cnd1 69 230 1.5e-26 PFAM
Pfam:HEAT_2 85 182 5.1e-9 PFAM
Pfam:Adaptin_N 90 496 4e-125 PFAM
low complexity region 587 605 N/A INTRINSIC
low complexity region 616 637 N/A INTRINSIC
Alpha_adaptinC2 683 793 2.94e-18 SMART
B2-adapt-app_C 802 912 9.93e-56 SMART
Meta Mutation Damage Score 0.0763 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik T C 7: 125,318,595 M53T unknown Het
Abcb11 T A 2: 69,259,476 probably benign Het
Acap2 C G 16: 31,110,945 A432P probably damaging Het
Adamtsl1 A G 4: 86,228,012 R302G probably damaging Het
Atp13a3 T A 16: 30,352,298 T310S possibly damaging Het
Atp6v1b1 T C 6: 83,757,852 V382A probably benign Het
Atp6v1g1 T A 4: 63,550,067 F102L probably benign Het
B430306N03Rik T A 17: 48,316,782 V37D probably damaging Het
Cacna1d T C 14: 30,047,357 Y1872C possibly damaging Het
Carf T A 1: 60,109,411 Y54N probably damaging Het
Cct5 T C 15: 31,594,203 E256G probably damaging Het
Cd5 A G 19: 10,723,256 S295P probably benign Het
Cenpb T C 2: 131,178,597 probably benign Het
Cntnap3 A G 13: 64,794,262 M218T possibly damaging Het
Colec11 C T 12: 28,594,787 R236H probably damaging Het
Crem T A 18: 3,288,098 probably benign Het
Csnk2a1 A G 2: 152,254,281 N58S probably benign Het
Cyp2a4 T G 7: 26,312,308 M318R probably damaging Het
Dhrs1 T A 14: 55,743,659 Q98L probably null Het
Dnah11 G T 12: 118,113,871 Q1296K possibly damaging Het
Doxl2 A G 6: 48,977,602 E558G probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Eid2b C T 7: 28,277,773 probably benign Het
Exoc1 A T 5: 76,532,846 K28* probably null Het
Fam114a1 A G 5: 64,980,059 D115G probably benign Het
Fam151a A T 4: 106,735,563 probably null Het
Gc T C 5: 89,438,342 Y313C probably damaging Het
Gdpd1 A G 11: 87,035,268 Y284H probably benign Het
Gm21957 T A 7: 125,219,706 noncoding transcript Het
Golm1 G A 13: 59,645,185 Q169* probably null Het
Greb1l T C 18: 10,523,281 V813A probably damaging Het
Itih1 C T 14: 30,937,843 A279T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 T C 17: 67,817,623 C2893R probably damaging Het
Lama3 T A 18: 12,524,830 N334K probably benign Het
Loxhd1 A G 18: 77,384,946 D1053G probably damaging Het
Map3k20 A G 2: 72,398,385 K316R probably benign Het
Mapre3 A C 5: 30,863,202 probably null Het
Mfsd7a C T 5: 108,445,621 R117H probably damaging Het
Mgam T A 6: 40,761,028 probably null Het
Mical2 A C 7: 112,318,603 H389P probably benign Het
Mtmr2 A G 9: 13,799,952 D347G probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nodal A T 10: 61,423,298 E171D possibly damaging Het
Notch2 T C 3: 98,102,367 S537P probably damaging Het
Obox6 A G 7: 15,833,607 L305S probably damaging Het
Obscn T C 11: 59,078,256 D2715G probably damaging Het
Olfr154 A C 2: 85,663,746 S229R probably benign Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Pcca T C 14: 122,686,115 S404P probably damaging Het
Pcdh10 T C 3: 45,380,471 S407P probably damaging Het
Plekha5 C A 6: 140,570,318 probably null Het
Ptdss1 A G 13: 66,953,555 N72S probably benign Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Pygm G A 19: 6,391,481 probably null Het
Rab7 C T 6: 88,012,318 V57I probably benign Het
Rasl10a A G 11: 5,059,431 probably null Het
Rergl T C 6: 139,494,834 T106A probably benign Het
Rnf17 T G 14: 56,483,380 V1023G probably damaging Het
Rnf25 T A 1: 74,593,967 R409W probably damaging Het
Rps6ka1 T C 4: 133,872,969 M1V probably null Het
Rps6ka5 T C 12: 100,619,615 T140A possibly damaging Het
Sbno2 T A 10: 80,057,856 I1204F possibly damaging Het
Serpina16 A T 12: 103,675,262 I68N probably damaging Het
Slc35a5 A G 16: 45,144,265 S202P probably damaging Het
Slc35g3 G C 11: 69,760,946 S93W probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Spag1 T C 15: 36,227,141 L648P probably damaging Het
Tagap1 T C 17: 6,956,703 D198G probably benign Het
Tedc2 T C 17: 24,217,900 E287G probably damaging Het
Tjp1 C A 7: 65,312,921 R1089S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ttc38 T A 15: 85,838,727 D125E probably benign Het
Uggt1 C T 1: 36,192,414 R490Q probably null Het
Uroc1 T G 6: 90,344,114 L224R probably damaging Het
Vmn1r228 A T 17: 20,777,193 I21N possibly damaging Het
Vmn2r102 T G 17: 19,676,687 L99V probably damaging Het
Vps13c C T 9: 67,950,289 S2601F probably benign Het
Zfp462 T C 4: 55,010,830 L932P probably damaging Het
Other mutations in Ap2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ap2b1 APN 11 83333158 missense probably damaging 0.99
IGL01583:Ap2b1 APN 11 83324611 missense possibly damaging 0.61
IGL01753:Ap2b1 APN 11 83321973 missense probably damaging 1.00
IGL01992:Ap2b1 APN 11 83335530 missense probably damaging 1.00
IGL02192:Ap2b1 APN 11 83346766 missense possibly damaging 0.48
IGL02315:Ap2b1 APN 11 83336799 missense probably damaging 0.96
IGL03235:Ap2b1 APN 11 83341384 missense probably benign 0.41
P0045:Ap2b1 UTSW 11 83368026 missense probably damaging 1.00
R0121:Ap2b1 UTSW 11 83321967 missense possibly damaging 0.66
R0334:Ap2b1 UTSW 11 83367874 splice site probably benign
R1222:Ap2b1 UTSW 11 83346738 missense probably benign 0.06
R1297:Ap2b1 UTSW 11 83333109 missense probably damaging 1.00
R1653:Ap2b1 UTSW 11 83346831 missense probably damaging 1.00
R1719:Ap2b1 UTSW 11 83324604 missense probably damaging 1.00
R1885:Ap2b1 UTSW 11 83390735 missense probably damaging 0.99
R1886:Ap2b1 UTSW 11 83390735 missense probably damaging 0.99
R1965:Ap2b1 UTSW 11 83346895 missense probably benign 0.00
R1966:Ap2b1 UTSW 11 83346895 missense probably benign 0.00
R2046:Ap2b1 UTSW 11 83336386 missense probably benign 0.14
R2132:Ap2b1 UTSW 11 83324761 splice site probably benign
R3615:Ap2b1 UTSW 11 83324565 missense possibly damaging 0.84
R3616:Ap2b1 UTSW 11 83324565 missense possibly damaging 0.84
R3983:Ap2b1 UTSW 11 83390716 missense probably damaging 1.00
R4124:Ap2b1 UTSW 11 83365645 critical splice acceptor site probably null
R4125:Ap2b1 UTSW 11 83365645 critical splice acceptor site probably null
R4198:Ap2b1 UTSW 11 83342603 missense probably damaging 1.00
R4202:Ap2b1 UTSW 11 83335604 critical splice donor site probably null
R4543:Ap2b1 UTSW 11 83324650 missense probably damaging 1.00
R4583:Ap2b1 UTSW 11 83397779 missense probably benign 0.00
R4589:Ap2b1 UTSW 11 83333011 nonsense probably null
R4916:Ap2b1 UTSW 11 83390706 missense probably damaging 1.00
R5005:Ap2b1 UTSW 11 83339392 missense probably damaging 1.00
R5385:Ap2b1 UTSW 11 83342601 missense probably damaging 1.00
R5510:Ap2b1 UTSW 11 83336737 intron probably null
R5738:Ap2b1 UTSW 11 83336430 unclassified probably null
R6023:Ap2b1 UTSW 11 83335398 missense probably damaging 0.99
R6269:Ap2b1 UTSW 11 83346673 missense probably damaging 1.00
R6383:Ap2b1 UTSW 11 83346825 missense probably damaging 1.00
R6416:Ap2b1 UTSW 11 83308239 start codon destroyed probably null 1.00
R6502:Ap2b1 UTSW 11 83342679 missense probably damaging 0.97
R6810:Ap2b1 UTSW 11 83335491 missense possibly damaging 0.89
R6969:Ap2b1 UTSW 11 83389726 missense probably damaging 0.99
R7238:Ap2b1 UTSW 11 83333122 missense possibly damaging 0.91
R7241:Ap2b1 UTSW 11 83351105 missense probably benign 0.16
R7429:Ap2b1 UTSW 11 83367998 missense probably benign 0.00
R7588:Ap2b1 UTSW 11 83324522 missense probably benign 0.00
R7635:Ap2b1 UTSW 11 83389728 missense probably benign 0.09
R7651:Ap2b1 UTSW 11 83339430 critical splice donor site probably null
R7753:Ap2b1 UTSW 11 83367907 nonsense probably null
X0064:Ap2b1 UTSW 11 83324569 missense probably damaging 1.00
Z1177:Ap2b1 UTSW 11 83365753 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAACCATTCCCACGGCAGTC -3'
(R):5'- GACATACTGCATCGCATTAAACAG -3'

Sequencing Primer
(F):5'- AGTCACGCGCTGCTTTG -3'
(R):5'- ACTGCATCGCATTAAACAGAATAG -3'
Posted On2014-09-18