Mutagenetix > Incidental Mutation

Incidental Mutation 'R2086:Cntnap3'

230018

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

040091-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R2086 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64794262 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 218 (M218T)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091554
AA Change: M218T

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: M218T

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Meta Mutation Damage Score

0.1735

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930533L02Rik	T	C	7: 125,318,595	M53T	unknown	Het
Abcb11	T	A	2: 69,259,476		probably benign	Het
Acap2	C	G	16: 31,110,945	A432P	probably damaging	Het
Adamtsl1	A	G	4: 86,228,012	R302G	probably damaging	Het
Ap2b1	T	G	11: 83,351,118	S608A	possibly damaging	Het
Atp13a3	T	A	16: 30,352,298	T310S	possibly damaging	Het
Atp6v1b1	T	C	6: 83,757,852	V382A	probably benign	Het
Atp6v1g1	T	A	4: 63,550,067	F102L	probably benign	Het
B430306N03Rik	T	A	17: 48,316,782	V37D	probably damaging	Het
Cacna1d	T	C	14: 30,047,357	Y1872C	possibly damaging	Het
Carf	T	A	1: 60,109,411	Y54N	probably damaging	Het
Cct5	T	C	15: 31,594,203	E256G	probably damaging	Het
Cd5	A	G	19: 10,723,256	S295P	probably benign	Het
Cenpb	T	C	2: 131,178,597		probably benign	Het
Colec11	C	T	12: 28,594,787	R236H	probably damaging	Het
Crem	T	A	18: 3,288,098		probably benign	Het
Csnk2a1	A	G	2: 152,254,281	N58S	probably benign	Het
Cyp2a4	T	G	7: 26,312,308	M318R	probably damaging	Het
Dhrs1	T	A	14: 55,743,659	Q98L	probably null	Het
Dnah11	G	T	12: 118,113,871	Q1296K	possibly damaging	Het
Doxl2	A	G	6: 48,977,602	E558G	probably damaging	Het
Edc4	T	A	8: 105,888,002	D105E	probably damaging	Het
Eid2b	C	T	7: 28,277,773		probably benign	Het
Exoc1	A	T	5: 76,532,846	K28*	probably null	Het
Fam114a1	A	G	5: 64,980,059	D115G	probably benign	Het
Fam151a	A	T	4: 106,735,563		probably null	Het
Gc	T	C	5: 89,438,342	Y313C	probably damaging	Het
Gdpd1	A	G	11: 87,035,268	Y284H	probably benign	Het
Gm21957	T	A	7: 125,219,706		noncoding transcript	Het
Golm1	G	A	13: 59,645,185	Q169*	probably null	Het
Greb1l	T	C	18: 10,523,281	V813A	probably damaging	Het
Itih1	C	T	14: 30,937,843	A279T	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lama1	T	C	17: 67,817,623	C2893R	probably damaging	Het
Lama3	T	A	18: 12,524,830	N334K	probably benign	Het
Loxhd1	A	G	18: 77,384,946	D1053G	probably damaging	Het
Map3k20	A	G	2: 72,398,385	K316R	probably benign	Het
Mapre3	A	C	5: 30,863,202		probably null	Het
Mfsd7a	C	T	5: 108,445,621	R117H	probably damaging	Het
Mgam	T	A	6: 40,761,028		probably null	Het
Mical2	A	C	7: 112,318,603	H389P	probably benign	Het
Mtmr2	A	G	9: 13,799,952	D347G	probably damaging	Het
Nbeal2	G	A	9: 110,634,071	L1309F	probably benign	Het
Nid2	G	A	14: 19,778,043	G516S	probably benign	Het
Nodal	A	T	10: 61,423,298	E171D	possibly damaging	Het
Notch2	T	C	3: 98,102,367	S537P	probably damaging	Het
Obox6	A	G	7: 15,833,607	L305S	probably damaging	Het
Obscn	T	C	11: 59,078,256	D2715G	probably damaging	Het
Olfr154	A	C	2: 85,663,746	S229R	probably benign	Het
Olfr728	T	A	14: 50,140,123	N172I	probably damaging	Het
Pcca	T	C	14: 122,686,115	S404P	probably damaging	Het
Pcdh10	T	C	3: 45,380,471	S407P	probably damaging	Het
Plekha5	C	A	6: 140,570,318		probably null	Het
Ptdss1	A	G	13: 66,953,555	N72S	probably benign	Het
Ptprs	T	C	17: 56,454,984	I43V	probably null	Het
Pygm	G	A	19: 6,391,481		probably null	Het
Rab7	C	T	6: 88,012,318	V57I	probably benign	Het
Rasl10a	A	G	11: 5,059,431		probably null	Het
Rergl	T	C	6: 139,494,834	T106A	probably benign	Het
Rnf17	T	G	14: 56,483,380	V1023G	probably damaging	Het
Rnf25	T	A	1: 74,593,967	R409W	probably damaging	Het
Rps6ka1	T	C	4: 133,872,969	M1V	probably null	Het
Rps6ka5	T	C	12: 100,619,615	T140A	possibly damaging	Het
Sbno2	T	A	10: 80,057,856	I1204F	possibly damaging	Het
Serpina16	A	T	12: 103,675,262	I68N	probably damaging	Het
Slc35a5	A	G	16: 45,144,265	S202P	probably damaging	Het
Slc35g3	G	C	11: 69,760,946	S93W	probably damaging	Het
Smc1b	A	G	15: 85,121,851		probably benign	Het
Spag1	T	C	15: 36,227,141	L648P	probably damaging	Het
Tagap1	T	C	17: 6,956,703	D198G	probably benign	Het
Tedc2	T	C	17: 24,217,900	E287G	probably damaging	Het
Tjp1	C	A	7: 65,312,921	R1089S	probably damaging	Het
Tnrc6a	CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT	CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT	7: 123,162,446		probably benign	Het
Ttc38	T	A	15: 85,838,727	D125E	probably benign	Het
Uggt1	C	T	1: 36,192,414	R490Q	probably null	Het
Uroc1	T	G	6: 90,344,114	L224R	probably damaging	Het
Vmn1r228	A	T	17: 20,777,193	I21N	possibly damaging	Het
Vmn2r102	T	G	17: 19,676,687	L99V	probably damaging	Het
Vps13c	C	T	9: 67,950,289	S2601F	probably benign	Het
Zfp462	T	C	4: 55,010,830	L932P	probably damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCTAGCTGAAAAGATCAAGTATCC -3'
(R):5'- ACTACATCAGGGACTTGTCAAAC -3'

Sequencing Primer
(F):5'- CTGAAAAGATCAAGTATCCACAGATG -3'
(R):5'- GAGAGATAGGAATAGCATCTCTCTC -3'

Posted On

2014-09-18