Incidental Mutation 'R2086:Rnf17'
ID230025
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
MMRRC Submission 040091-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R2086 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 56483380 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 1023 (V1023G)
Ref Sequence ENSEMBL: ENSMUSP00000093469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793]
Predicted Effect probably damaging
Transcript: ENSMUST00000095793
AA Change: V1023G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: V1023G

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225621
Meta Mutation Damage Score 0.5577 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik T C 7: 125,318,595 M53T unknown Het
Abcb11 T A 2: 69,259,476 probably benign Het
Acap2 C G 16: 31,110,945 A432P probably damaging Het
Adamtsl1 A G 4: 86,228,012 R302G probably damaging Het
Ap2b1 T G 11: 83,351,118 S608A possibly damaging Het
Atp13a3 T A 16: 30,352,298 T310S possibly damaging Het
Atp6v1b1 T C 6: 83,757,852 V382A probably benign Het
Atp6v1g1 T A 4: 63,550,067 F102L probably benign Het
B430306N03Rik T A 17: 48,316,782 V37D probably damaging Het
Cacna1d T C 14: 30,047,357 Y1872C possibly damaging Het
Carf T A 1: 60,109,411 Y54N probably damaging Het
Cct5 T C 15: 31,594,203 E256G probably damaging Het
Cd5 A G 19: 10,723,256 S295P probably benign Het
Cenpb T C 2: 131,178,597 probably benign Het
Cntnap3 A G 13: 64,794,262 M218T possibly damaging Het
Colec11 C T 12: 28,594,787 R236H probably damaging Het
Crem T A 18: 3,288,098 probably benign Het
Csnk2a1 A G 2: 152,254,281 N58S probably benign Het
Cyp2a4 T G 7: 26,312,308 M318R probably damaging Het
Dhrs1 T A 14: 55,743,659 Q98L probably null Het
Dnah11 G T 12: 118,113,871 Q1296K possibly damaging Het
Doxl2 A G 6: 48,977,602 E558G probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Eid2b C T 7: 28,277,773 probably benign Het
Exoc1 A T 5: 76,532,846 K28* probably null Het
Fam114a1 A G 5: 64,980,059 D115G probably benign Het
Fam151a A T 4: 106,735,563 probably null Het
Gc T C 5: 89,438,342 Y313C probably damaging Het
Gdpd1 A G 11: 87,035,268 Y284H probably benign Het
Gm21957 T A 7: 125,219,706 noncoding transcript Het
Golm1 G A 13: 59,645,185 Q169* probably null Het
Greb1l T C 18: 10,523,281 V813A probably damaging Het
Itih1 C T 14: 30,937,843 A279T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 T C 17: 67,817,623 C2893R probably damaging Het
Lama3 T A 18: 12,524,830 N334K probably benign Het
Loxhd1 A G 18: 77,384,946 D1053G probably damaging Het
Map3k20 A G 2: 72,398,385 K316R probably benign Het
Mapre3 A C 5: 30,863,202 probably null Het
Mfsd7a C T 5: 108,445,621 R117H probably damaging Het
Mgam T A 6: 40,761,028 probably null Het
Mical2 A C 7: 112,318,603 H389P probably benign Het
Mtmr2 A G 9: 13,799,952 D347G probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nodal A T 10: 61,423,298 E171D possibly damaging Het
Notch2 T C 3: 98,102,367 S537P probably damaging Het
Obox6 A G 7: 15,833,607 L305S probably damaging Het
Obscn T C 11: 59,078,256 D2715G probably damaging Het
Olfr154 A C 2: 85,663,746 S229R probably benign Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Pcca T C 14: 122,686,115 S404P probably damaging Het
Pcdh10 T C 3: 45,380,471 S407P probably damaging Het
Plekha5 C A 6: 140,570,318 probably null Het
Ptdss1 A G 13: 66,953,555 N72S probably benign Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Pygm G A 19: 6,391,481 probably null Het
Rab7 C T 6: 88,012,318 V57I probably benign Het
Rasl10a A G 11: 5,059,431 probably null Het
Rergl T C 6: 139,494,834 T106A probably benign Het
Rnf25 T A 1: 74,593,967 R409W probably damaging Het
Rps6ka1 T C 4: 133,872,969 M1V probably null Het
Rps6ka5 T C 12: 100,619,615 T140A possibly damaging Het
Sbno2 T A 10: 80,057,856 I1204F possibly damaging Het
Serpina16 A T 12: 103,675,262 I68N probably damaging Het
Slc35a5 A G 16: 45,144,265 S202P probably damaging Het
Slc35g3 G C 11: 69,760,946 S93W probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Spag1 T C 15: 36,227,141 L648P probably damaging Het
Tagap1 T C 17: 6,956,703 D198G probably benign Het
Tedc2 T C 17: 24,217,900 E287G probably damaging Het
Tjp1 C A 7: 65,312,921 R1089S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ttc38 T A 15: 85,838,727 D125E probably benign Het
Uggt1 C T 1: 36,192,414 R490Q probably null Het
Uroc1 T G 6: 90,344,114 L224R probably damaging Het
Vmn1r228 A T 17: 20,777,193 I21N possibly damaging Het
Vmn2r102 T G 17: 19,676,687 L99V probably damaging Het
Vps13c C T 9: 67,950,289 S2601F probably benign Het
Zfp462 T C 4: 55,010,830 L932P probably damaging Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 splice site probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56512332 splice site probably null
R7527:Rnf17 UTSW 14 56516438 missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56438878 missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56462072 critical splice donor site probably null
R7772:Rnf17 UTSW 14 56477687 missense probably benign 0.27
R8092:Rnf17 UTSW 14 56487022 missense probably benign 0.00
R8150:Rnf17 UTSW 14 56421136 missense probably benign 0.19
R8203:Rnf17 UTSW 14 56467722 missense probably benign 0.17
R8320:Rnf17 UTSW 14 56424542 frame shift probably null
R8321:Rnf17 UTSW 14 56424542 frame shift probably null
R8379:Rnf17 UTSW 14 56424542 frame shift probably null
R8380:Rnf17 UTSW 14 56424542 frame shift probably null
R8381:Rnf17 UTSW 14 56424542 frame shift probably null
R8382:Rnf17 UTSW 14 56424542 frame shift probably null
R8383:Rnf17 UTSW 14 56424542 frame shift probably null
Z1177:Rnf17 UTSW 14 56467706 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GAGGCCAGATTCTCAGAATGGTTAC -3'
(R):5'- TCCTTAATGAATTCAGGCATGATGG -3'

Sequencing Primer
(F):5'- GATTCTCAGAATGGTTACAGACAAAC -3'
(R):5'- CTGGTCTACATAGCAAGTTCCAGG -3'
Posted On2014-09-18