Incidental Mutation 'R2086:Cct5'
ID230028
Institutional Source Beutler Lab
Gene Symbol Cct5
Ensembl Gene ENSMUSG00000022234
Gene Namechaperonin containing Tcp1, subunit 5 (epsilon)
SynonymsCcte, TCPE
MMRRC Submission 040091-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2086 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location31590800-31601804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31594203 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 256 (E256G)
Ref Sequence ENSEMBL: ENSMUSP00000022842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022842] [ENSMUST00000070918] [ENSMUST00000161266] [ENSMUST00000226951]
Predicted Effect probably damaging
Transcript: ENSMUST00000022842
AA Change: E256G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022842
Gene: ENSMUSG00000022234
AA Change: E256G

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 44 537 7.7e-160 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070918
SMART Domains Protein: ENSMUSP00000070314
Gene: ENSMUSG00000022235

DomainStartEndE-ValueType
Pfam:DLH 30 245 6e-40 PFAM
Pfam:Abhydrolase_5 44 213 1.1e-16 PFAM
Pfam:FSH1 77 214 1.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160174
Predicted Effect probably benign
Transcript: ENSMUST00000161266
SMART Domains Protein: ENSMUSP00000125566
Gene: ENSMUSG00000022234

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 6 199 5.4e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226951
Meta Mutation Damage Score 0.9188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Mutations in this gene cause hereditary sensory and autonomic neuropathy with spastic paraplegia (HSNSP). Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 5 and 13. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik T C 7: 125,318,595 M53T unknown Het
Abcb11 T A 2: 69,259,476 probably benign Het
Acap2 C G 16: 31,110,945 A432P probably damaging Het
Adamtsl1 A G 4: 86,228,012 R302G probably damaging Het
Ap2b1 T G 11: 83,351,118 S608A possibly damaging Het
Atp13a3 T A 16: 30,352,298 T310S possibly damaging Het
Atp6v1b1 T C 6: 83,757,852 V382A probably benign Het
Atp6v1g1 T A 4: 63,550,067 F102L probably benign Het
B430306N03Rik T A 17: 48,316,782 V37D probably damaging Het
Cacna1d T C 14: 30,047,357 Y1872C possibly damaging Het
Carf T A 1: 60,109,411 Y54N probably damaging Het
Cd5 A G 19: 10,723,256 S295P probably benign Het
Cenpb T C 2: 131,178,597 probably benign Het
Cntnap3 A G 13: 64,794,262 M218T possibly damaging Het
Colec11 C T 12: 28,594,787 R236H probably damaging Het
Crem T A 18: 3,288,098 probably benign Het
Csnk2a1 A G 2: 152,254,281 N58S probably benign Het
Cyp2a4 T G 7: 26,312,308 M318R probably damaging Het
Dhrs1 T A 14: 55,743,659 Q98L probably null Het
Dnah11 G T 12: 118,113,871 Q1296K possibly damaging Het
Doxl2 A G 6: 48,977,602 E558G probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Eid2b C T 7: 28,277,773 probably benign Het
Exoc1 A T 5: 76,532,846 K28* probably null Het
Fam114a1 A G 5: 64,980,059 D115G probably benign Het
Fam151a A T 4: 106,735,563 probably null Het
Gc T C 5: 89,438,342 Y313C probably damaging Het
Gdpd1 A G 11: 87,035,268 Y284H probably benign Het
Gm21957 T A 7: 125,219,706 noncoding transcript Het
Golm1 G A 13: 59,645,185 Q169* probably null Het
Greb1l T C 18: 10,523,281 V813A probably damaging Het
Itih1 C T 14: 30,937,843 A279T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 T C 17: 67,817,623 C2893R probably damaging Het
Lama3 T A 18: 12,524,830 N334K probably benign Het
Loxhd1 A G 18: 77,384,946 D1053G probably damaging Het
Map3k20 A G 2: 72,398,385 K316R probably benign Het
Mapre3 A C 5: 30,863,202 probably null Het
Mfsd7a C T 5: 108,445,621 R117H probably damaging Het
Mgam T A 6: 40,761,028 probably null Het
Mical2 A C 7: 112,318,603 H389P probably benign Het
Mtmr2 A G 9: 13,799,952 D347G probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nodal A T 10: 61,423,298 E171D possibly damaging Het
Notch2 T C 3: 98,102,367 S537P probably damaging Het
Obox6 A G 7: 15,833,607 L305S probably damaging Het
Obscn T C 11: 59,078,256 D2715G probably damaging Het
Olfr154 A C 2: 85,663,746 S229R probably benign Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Pcca T C 14: 122,686,115 S404P probably damaging Het
Pcdh10 T C 3: 45,380,471 S407P probably damaging Het
Plekha5 C A 6: 140,570,318 probably null Het
Ptdss1 A G 13: 66,953,555 N72S probably benign Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Pygm G A 19: 6,391,481 probably null Het
Rab7 C T 6: 88,012,318 V57I probably benign Het
Rasl10a A G 11: 5,059,431 probably null Het
Rergl T C 6: 139,494,834 T106A probably benign Het
Rnf17 T G 14: 56,483,380 V1023G probably damaging Het
Rnf25 T A 1: 74,593,967 R409W probably damaging Het
Rps6ka1 T C 4: 133,872,969 M1V probably null Het
Rps6ka5 T C 12: 100,619,615 T140A possibly damaging Het
Sbno2 T A 10: 80,057,856 I1204F possibly damaging Het
Serpina16 A T 12: 103,675,262 I68N probably damaging Het
Slc35a5 A G 16: 45,144,265 S202P probably damaging Het
Slc35g3 G C 11: 69,760,946 S93W probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Spag1 T C 15: 36,227,141 L648P probably damaging Het
Tagap1 T C 17: 6,956,703 D198G probably benign Het
Tedc2 T C 17: 24,217,900 E287G probably damaging Het
Tjp1 C A 7: 65,312,921 R1089S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ttc38 T A 15: 85,838,727 D125E probably benign Het
Uggt1 C T 1: 36,192,414 R490Q probably null Het
Uroc1 T G 6: 90,344,114 L224R probably damaging Het
Vmn1r228 A T 17: 20,777,193 I21N possibly damaging Het
Vmn2r102 T G 17: 19,676,687 L99V probably damaging Het
Vps13c C T 9: 67,950,289 S2601F probably benign Het
Zfp462 T C 4: 55,010,830 L932P probably damaging Het
Other mutations in Cct5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Cct5 APN 15 31590927 unclassified probably benign
IGL02656:Cct5 APN 15 31597430 missense probably damaging 1.00
IGL03188:Cct5 APN 15 31598002 missense probably benign 0.10
IGL03052:Cct5 UTSW 15 31597487 missense probably damaging 1.00
R0279:Cct5 UTSW 15 31591031 missense probably damaging 1.00
R1933:Cct5 UTSW 15 31591008 missense probably benign 0.05
R4482:Cct5 UTSW 15 31597569 missense probably damaging 1.00
R5331:Cct5 UTSW 15 31594302 unclassified probably benign
R5618:Cct5 UTSW 15 31598015 missense possibly damaging 0.52
X0023:Cct5 UTSW 15 31601659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGACTGATACCCAACACAGG -3'
(R):5'- CGTTGACAAGGACTTCAGCC -3'

Sequencing Primer
(F):5'- ACACAGGTTGTACTGCATGC -3'
(R):5'- GACTTCAGCCACCCACAGATG -3'
Posted On2014-09-18