Mutagenetix > Incidental Mutations

Incidental Mutation 'R2086:Greb1l'

230047

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

040091-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2086 (G1)

Quality Score

162

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10523281 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 813 (V813A)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048977
AA Change: V813A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: V813A

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172532
AA Change: V704A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: V704A

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172680

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Meta Mutation Damage Score

0.1987

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

99% (80/81)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930533L02Rik	T	C	7: 125,318,595	M53T	unknown	Het
Abcb11	T	A	2: 69,259,476		probably benign	Het
Acap2	C	G	16: 31,110,945	A432P	probably damaging	Het
Adamtsl1	A	G	4: 86,228,012	R302G	probably damaging	Het
Ap2b1	T	G	11: 83,351,118	S608A	possibly damaging	Het
Atp13a3	T	A	16: 30,352,298	T310S	possibly damaging	Het
Atp6v1b1	T	C	6: 83,757,852	V382A	probably benign	Het
Atp6v1g1	T	A	4: 63,550,067	F102L	probably benign	Het
B430306N03Rik	T	A	17: 48,316,782	V37D	probably damaging	Het
Cacna1d	T	C	14: 30,047,357	Y1872C	possibly damaging	Het
Carf	T	A	1: 60,109,411	Y54N	probably damaging	Het
Cct5	T	C	15: 31,594,203	E256G	probably damaging	Het
Cd5	A	G	19: 10,723,256	S295P	probably benign	Het
Cenpb	T	C	2: 131,178,597		probably benign	Het
Cntnap3	A	G	13: 64,794,262	M218T	possibly damaging	Het
Colec11	C	T	12: 28,594,787	R236H	probably damaging	Het
Crem	T	A	18: 3,288,098		probably benign	Het
Csnk2a1	A	G	2: 152,254,281	N58S	probably benign	Het
Cyp2a4	T	G	7: 26,312,308	M318R	probably damaging	Het
Dhrs1	T	A	14: 55,743,659	Q98L	probably null	Het
Dnah11	G	T	12: 118,113,871	Q1296K	possibly damaging	Het
Doxl2	A	G	6: 48,977,602	E558G	probably damaging	Het
Edc4	T	A	8: 105,888,002	D105E	probably damaging	Het
Eid2b	C	T	7: 28,277,773		probably benign	Het
Exoc1	A	T	5: 76,532,846	K28*	probably null	Het
Fam114a1	A	G	5: 64,980,059	D115G	probably benign	Het
Fam151a	A	T	4: 106,735,563		probably null	Het
Gc	T	C	5: 89,438,342	Y313C	probably damaging	Het
Gdpd1	A	G	11: 87,035,268	Y284H	probably benign	Het
Gm21957	T	A	7: 125,219,706		noncoding transcript	Het
Golm1	G	A	13: 59,645,185	Q169*	probably null	Het
Itih1	C	T	14: 30,937,843	A279T	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lama1	T	C	17: 67,817,623	C2893R	probably damaging	Het
Lama3	T	A	18: 12,524,830	N334K	probably benign	Het
Loxhd1	A	G	18: 77,384,946	D1053G	probably damaging	Het
Map3k20	A	G	2: 72,398,385	K316R	probably benign	Het
Mapre3	A	C	5: 30,863,202		probably null	Het
Mfsd7a	C	T	5: 108,445,621	R117H	probably damaging	Het
Mgam	T	A	6: 40,761,028		probably null	Het
Mical2	A	C	7: 112,318,603	H389P	probably benign	Het
Mtmr2	A	G	9: 13,799,952	D347G	probably damaging	Het
Nbeal2	G	A	9: 110,634,071	L1309F	probably benign	Het
Nid2	G	A	14: 19,778,043	G516S	probably benign	Het
Nodal	A	T	10: 61,423,298	E171D	possibly damaging	Het
Notch2	T	C	3: 98,102,367	S537P	probably damaging	Het
Obox6	A	G	7: 15,833,607	L305S	probably damaging	Het
Obscn	T	C	11: 59,078,256	D2715G	probably damaging	Het
Olfr154	A	C	2: 85,663,746	S229R	probably benign	Het
Olfr728	T	A	14: 50,140,123	N172I	probably damaging	Het
Pcca	T	C	14: 122,686,115	S404P	probably damaging	Het
Pcdh10	T	C	3: 45,380,471	S407P	probably damaging	Het
Plekha5	C	A	6: 140,570,318		probably null	Het
Ptdss1	A	G	13: 66,953,555	N72S	probably benign	Het
Ptprs	T	C	17: 56,454,984	I43V	probably null	Het
Pygm	G	A	19: 6,391,481		probably null	Het
Rab7	C	T	6: 88,012,318	V57I	probably benign	Het
Rasl10a	A	G	11: 5,059,431		probably null	Het
Rergl	T	C	6: 139,494,834	T106A	probably benign	Het
Rnf17	T	G	14: 56,483,380	V1023G	probably damaging	Het
Rnf25	T	A	1: 74,593,967	R409W	probably damaging	Het
Rps6ka1	T	C	4: 133,872,969	M1V	probably null	Het
Rps6ka5	T	C	12: 100,619,615	T140A	possibly damaging	Het
Sbno2	T	A	10: 80,057,856	I1204F	possibly damaging	Het
Serpina16	A	T	12: 103,675,262	I68N	probably damaging	Het
Slc35a5	A	G	16: 45,144,265	S202P	probably damaging	Het
Slc35g3	G	C	11: 69,760,946	S93W	probably damaging	Het
Smc1b	A	G	15: 85,121,851		probably benign	Het
Spag1	T	C	15: 36,227,141	L648P	probably damaging	Het
Tagap1	T	C	17: 6,956,703	D198G	probably benign	Het
Tedc2	T	C	17: 24,217,900	E287G	probably damaging	Het
Tjp1	C	A	7: 65,312,921	R1089S	probably damaging	Het
Tnrc6a	CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT	CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT	7: 123,162,446		probably benign	Het
Ttc38	T	A	15: 85,838,727	D125E	probably benign	Het
Uggt1	C	T	1: 36,192,414	R490Q	probably null	Het
Uroc1	T	G	6: 90,344,114	L224R	probably damaging	Het
Vmn1r228	A	T	17: 20,777,193	I21N	possibly damaging	Het
Vmn2r102	T	G	17: 19,676,687	L99V	probably damaging	Het
Vps13c	C	T	9: 67,950,289	S2601F	probably benign	Het
Zfp462	T	C	4: 55,010,830	L932P	probably damaging	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7915:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATTCTGACTGGATCTGTCCC -3'
(R):5'- TGCTGTGTTTTACCAGGCCATG -3'

Sequencing Primer
(F):5'- CCCTCTCAGATAAAATAAGTCTGGTG -3'
(R):5'- CATGGCCATGTTCAGTTCCTGG -3'

Posted On

2014-09-18