Incidental Mutation 'R2086:Lama3'
ID 230048
Institutional Source Beutler Lab
Gene Symbol Lama3
Ensembl Gene ENSMUSG00000024421
Gene Name laminin, alpha 3
Synonyms [a]3B, nicein, 150kDa
MMRRC Submission 040091-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2086 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 12333819-12583013 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12524830 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 334 (N334K)
Ref Sequence ENSEMBL: ENSMUSP00000140104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092070] [ENSMUST00000188815]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000092070
AA Change: N1940K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: N1940K

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LamNT 38 294 1.46e-153 SMART
EGF_Lam 296 350 1.39e-4 SMART
EGF_Lam 353 420 2.66e-10 SMART
EGF_Lam 423 464 3.51e-10 SMART
EGF_Lam 488 530 1.73e-9 SMART
EGF_Lam 533 576 3.81e-11 SMART
EGF_like 579 625 1.82e-1 SMART
EGF_Lam 628 678 5.15e-8 SMART
EGF_Lam 681 725 3.54e-6 SMART
low complexity region 768 781 N/A INTRINSIC
EGF_Lam 1263 1306 3.15e-12 SMART
EGF_Lam 1309 1350 6.3e-3 SMART
EGF_Lam 1353 1399 1.49e-13 SMART
EGF_Lam 1402 1450 8.18e-11 SMART
LamB 1509 1638 4.34e-55 SMART
Pfam:Laminin_EGF 1647 1681 7.9e-5 PFAM
EGF_Lam 1684 1728 2.66e-10 SMART
EGF_Lam 1731 1781 7.81e-8 SMART
Pfam:Laminin_I 1836 2102 2.7e-93 PFAM
low complexity region 2185 2200 N/A INTRINSIC
coiled coil region 2211 2238 N/A INTRINSIC
LamG 2406 2566 1.67e-2 SMART
LamG 2614 2742 1.72e-17 SMART
LamG 2785 2900 3.96e-17 SMART
LamG 3005 3133 1.12e-34 SMART
LamG 3175 3308 3.41e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188815
AA Change: N334K

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140104
Gene: ENSMUSG00000024421
AA Change: N334K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_Lam 78 122 2.66e-10 SMART
EGF_Lam 125 175 7.81e-8 SMART
Pfam:Laminin_I 230 496 1e-90 PFAM
low complexity region 579 594 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
LamG 800 960 1.67e-2 SMART
LamG 1008 1136 1.72e-17 SMART
LamG 1179 1294 3.96e-17 SMART
LamG 1399 1527 1.12e-34 SMART
LamG 1569 1702 3.41e-30 SMART
Meta Mutation Damage Score 0.0647 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik T C 7: 125,318,595 M53T unknown Het
Abcb11 T A 2: 69,259,476 probably benign Het
Acap2 C G 16: 31,110,945 A432P probably damaging Het
Adamtsl1 A G 4: 86,228,012 R302G probably damaging Het
Ap2b1 T G 11: 83,351,118 S608A possibly damaging Het
Atp13a3 T A 16: 30,352,298 T310S possibly damaging Het
Atp6v1b1 T C 6: 83,757,852 V382A probably benign Het
Atp6v1g1 T A 4: 63,550,067 F102L probably benign Het
B430306N03Rik T A 17: 48,316,782 V37D probably damaging Het
Cacna1d T C 14: 30,047,357 Y1872C possibly damaging Het
Carf T A 1: 60,109,411 Y54N probably damaging Het
Cct5 T C 15: 31,594,203 E256G probably damaging Het
Cd5 A G 19: 10,723,256 S295P probably benign Het
Cenpb T C 2: 131,178,597 probably benign Het
Cntnap3 A G 13: 64,794,262 M218T possibly damaging Het
Colec11 C T 12: 28,594,787 R236H probably damaging Het
Crem T A 18: 3,288,098 probably benign Het
Csnk2a1 A G 2: 152,254,281 N58S probably benign Het
Cyp2a4 T G 7: 26,312,308 M318R probably damaging Het
Dhrs1 T A 14: 55,743,659 Q98L probably null Het
Dnah11 G T 12: 118,113,871 Q1296K possibly damaging Het
Doxl2 A G 6: 48,977,602 E558G probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Eid2b C T 7: 28,277,773 probably benign Het
Exoc1 A T 5: 76,532,846 K28* probably null Het
Fam114a1 A G 5: 64,980,059 D115G probably benign Het
Fam151a A T 4: 106,735,563 probably null Het
Gc T C 5: 89,438,342 Y313C probably damaging Het
Gdpd1 A G 11: 87,035,268 Y284H probably benign Het
Gm21957 T A 7: 125,219,706 noncoding transcript Het
Golm1 G A 13: 59,645,185 Q169* probably null Het
Greb1l T C 18: 10,523,281 V813A probably damaging Het
Itih1 C T 14: 30,937,843 A279T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 T C 17: 67,817,623 C2893R probably damaging Het
Loxhd1 A G 18: 77,384,946 D1053G probably damaging Het
Map3k20 A G 2: 72,398,385 K316R probably benign Het
Mapre3 A C 5: 30,863,202 probably null Het
Mfsd7a C T 5: 108,445,621 R117H probably damaging Het
Mgam T A 6: 40,761,028 probably null Het
Mical2 A C 7: 112,318,603 H389P probably benign Het
Mtmr2 A G 9: 13,799,952 D347G probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nodal A T 10: 61,423,298 E171D possibly damaging Het
Notch2 T C 3: 98,102,367 S537P probably damaging Het
Obox6 A G 7: 15,833,607 L305S probably damaging Het
Obscn T C 11: 59,078,256 D2715G probably damaging Het
Olfr154 A C 2: 85,663,746 S229R probably benign Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Pcca T C 14: 122,686,115 S404P probably damaging Het
Pcdh10 T C 3: 45,380,471 S407P probably damaging Het
Plekha5 C A 6: 140,570,318 probably null Het
Ptdss1 A G 13: 66,953,555 N72S probably benign Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Pygm G A 19: 6,391,481 probably null Het
Rab7 C T 6: 88,012,318 V57I probably benign Het
Rasl10a A G 11: 5,059,431 probably null Het
Rergl T C 6: 139,494,834 T106A probably benign Het
Rnf17 T G 14: 56,483,380 V1023G probably damaging Het
Rnf25 T A 1: 74,593,967 R409W probably damaging Het
Rps6ka1 T C 4: 133,872,969 M1V probably null Het
Rps6ka5 T C 12: 100,619,615 T140A possibly damaging Het
Sbno2 T A 10: 80,057,856 I1204F possibly damaging Het
Serpina16 A T 12: 103,675,262 I68N probably damaging Het
Slc35a5 A G 16: 45,144,265 S202P probably damaging Het
Slc35g3 G C 11: 69,760,946 S93W probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Spag1 T C 15: 36,227,141 L648P probably damaging Het
Tagap1 T C 17: 6,956,703 D198G probably benign Het
Tedc2 T C 17: 24,217,900 E287G probably damaging Het
Tjp1 C A 7: 65,312,921 R1089S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ttc38 T A 15: 85,838,727 D125E probably benign Het
Uggt1 C T 1: 36,192,414 R490Q probably null Het
Uroc1 T G 6: 90,344,114 L224R probably damaging Het
Vmn1r228 A T 17: 20,777,193 I21N possibly damaging Het
Vmn2r102 T G 17: 19,676,687 L99V probably damaging Het
Vps13c C T 9: 67,950,289 S2601F probably benign Het
Zfp462 T C 4: 55,010,830 L932P probably damaging Het
Other mutations in Lama3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Lama3 APN 18 12580292 missense probably benign
IGL00272:Lama3 APN 18 12491548 missense probably damaging 1.00
IGL00335:Lama3 APN 18 12449588 splice site probably benign
IGL00836:Lama3 APN 18 12472228 missense probably benign 0.01
IGL01017:Lama3 APN 18 12441143 critical splice donor site probably null
IGL01025:Lama3 APN 18 12481037 missense probably benign 0.09
IGL01394:Lama3 APN 18 12531926 missense probably null 0.39
IGL01545:Lama3 APN 18 12441131 missense probably benign 0.01
IGL01685:Lama3 APN 18 12453880 splice site probably benign
IGL01863:Lama3 APN 18 12419936 splice site probably benign
IGL01869:Lama3 APN 18 12524763 missense possibly damaging 0.94
IGL01894:Lama3 APN 18 12572064 missense probably benign 0.09
IGL02027:Lama3 APN 18 12516513 missense probably damaging 1.00
IGL02106:Lama3 APN 18 12468314 missense probably damaging 0.98
IGL02307:Lama3 APN 18 12581783 missense probably benign 0.09
IGL02342:Lama3 APN 18 12491476 missense probably damaging 1.00
IGL02377:Lama3 APN 18 12556750 missense possibly damaging 0.49
IGL02401:Lama3 APN 18 12557727 missense probably benign 0.02
IGL02517:Lama3 APN 18 12537858 critical splice donor site probably null
IGL02644:Lama3 APN 18 12525853 missense probably benign 0.12
IGL02733:Lama3 APN 18 12578127 missense probably damaging 0.99
IGL02932:Lama3 APN 18 12528801 missense probably damaging 1.00
IGL03006:Lama3 APN 18 12468368 splice site probably benign
IGL03038:Lama3 APN 18 12419250 missense probably damaging 0.99
IGL03064:Lama3 APN 18 12439349 missense possibly damaging 0.72
IGL03146:Lama3 APN 18 12527624 missense possibly damaging 0.66
IGL03233:Lama3 APN 18 12481038 missense probably damaging 1.00
IGL03255:Lama3 APN 18 12539703 missense probably damaging 1.00
IGL03369:Lama3 APN 18 12553283 missense probably benign 0.05
IGL03412:Lama3 APN 18 12419182 missense probably damaging 0.99
IGL02980:Lama3 UTSW 18 12553231 missense probably benign 0.01
IGL03014:Lama3 UTSW 18 12539967 missense possibly damaging 0.95
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0106:Lama3 UTSW 18 12403982 missense probably damaging 0.96
R0148:Lama3 UTSW 18 12448272 missense probably damaging 1.00
R0165:Lama3 UTSW 18 12524810 missense probably damaging 0.99
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0316:Lama3 UTSW 18 12519877 missense probably benign 0.09
R0325:Lama3 UTSW 18 12482126 missense probably damaging 1.00
R0365:Lama3 UTSW 18 12507007 missense probably damaging 0.96
R0390:Lama3 UTSW 18 12407563 missense probably benign 0.10
R0408:Lama3 UTSW 18 12456837 missense probably benign
R0449:Lama3 UTSW 18 12500512 splice site probably null
R0453:Lama3 UTSW 18 12465478 missense possibly damaging 0.63
R0480:Lama3 UTSW 18 12450424 missense possibly damaging 0.81
R0536:Lama3 UTSW 18 12525894 missense probably damaging 1.00
R0545:Lama3 UTSW 18 12561701 missense possibly damaging 0.90
R0567:Lama3 UTSW 18 12549252 missense probably benign
R0605:Lama3 UTSW 18 12506949 missense probably benign 0.02
R0617:Lama3 UTSW 18 12419258 critical splice donor site probably null
R0629:Lama3 UTSW 18 12419245 missense possibly damaging 0.79
R0671:Lama3 UTSW 18 12477590 missense possibly damaging 0.80
R0730:Lama3 UTSW 18 12456850 splice site probably benign
R1216:Lama3 UTSW 18 12421134 splice site probably benign
R1356:Lama3 UTSW 18 12500577 unclassified probably benign
R1386:Lama3 UTSW 18 12477370 missense probably benign 0.04
R1424:Lama3 UTSW 18 12519991 missense probably benign 0.13
R1426:Lama3 UTSW 18 12481098 critical splice donor site probably null
R1437:Lama3 UTSW 18 12549227 missense possibly damaging 0.46
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1472:Lama3 UTSW 18 12482045 missense probably benign 0.23
R1557:Lama3 UTSW 18 12513731 splice site probably benign
R1571:Lama3 UTSW 18 12539717 missense probably damaging 0.98
R1599:Lama3 UTSW 18 12450400 nonsense probably null
R1631:Lama3 UTSW 18 12407494 missense probably damaging 1.00
R1647:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1648:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1719:Lama3 UTSW 18 12479872 critical splice donor site probably null
R1757:Lama3 UTSW 18 12465499 missense probably benign 0.10
R1766:Lama3 UTSW 18 12402062 missense probably damaging 1.00
R1853:Lama3 UTSW 18 12513705 missense possibly damaging 0.75
R1856:Lama3 UTSW 18 12537781 nonsense probably null
R1909:Lama3 UTSW 18 12581798 missense probably benign 0.19
R1913:Lama3 UTSW 18 12495279 missense probably benign 0.15
R1975:Lama3 UTSW 18 12453863 missense probably damaging 1.00
R2014:Lama3 UTSW 18 12524721 splice site probably benign
R2059:Lama3 UTSW 18 12528333 missense probably damaging 0.98
R2060:Lama3 UTSW 18 12528726 missense probably benign 0.30
R2115:Lama3 UTSW 18 12402849 missense possibly damaging 0.94
R2291:Lama3 UTSW 18 12525079 missense probably damaging 0.98
R2860:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2861:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2862:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R3410:Lama3 UTSW 18 12413858 critical splice donor site probably null
R3614:Lama3 UTSW 18 12448288 missense probably benign 0.03
R3696:Lama3 UTSW 18 12439475 splice site probably benign
R3752:Lama3 UTSW 18 12507029 missense probably damaging 1.00
R3967:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3968:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3969:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3970:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R4088:Lama3 UTSW 18 12504308 nonsense probably null
R4118:Lama3 UTSW 18 12450431 missense probably benign 0.01
R4222:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4223:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4224:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4225:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4367:Lama3 UTSW 18 12513690 missense probably damaging 1.00
R4404:Lama3 UTSW 18 12582531 missense probably benign 0.01
R4424:Lama3 UTSW 18 12519872 nonsense probably null
R4483:Lama3 UTSW 18 12549253 missense probably benign 0.32
R4484:Lama3 UTSW 18 12481088 missense probably benign
R4516:Lama3 UTSW 18 12495358 missense probably damaging 1.00
R4556:Lama3 UTSW 18 12479759 missense possibly damaging 0.63
R4616:Lama3 UTSW 18 12504397 critical splice donor site probably null
R4702:Lama3 UTSW 18 12578029 nonsense probably null
R4704:Lama3 UTSW 18 12553223 missense probably benign 0.08
R4750:Lama3 UTSW 18 12504359 missense probably benign 0.25
R4753:Lama3 UTSW 18 12482084 missense probably damaging 1.00
R4767:Lama3 UTSW 18 12500563 missense probably benign 0.32
R4777:Lama3 UTSW 18 12413771 missense probably damaging 1.00
R4782:Lama3 UTSW 18 12411570 nonsense probably null
R4784:Lama3 UTSW 18 12449544 missense probably benign 0.20
R4816:Lama3 UTSW 18 12477604 missense possibly damaging 0.93
R4833:Lama3 UTSW 18 12441131 missense probably benign 0.01
R4854:Lama3 UTSW 18 12411542 missense probably benign 0.00
R4863:Lama3 UTSW 18 12498678 intron probably benign
R4863:Lama3 UTSW 18 12539793 missense probably damaging 0.99
R4953:Lama3 UTSW 18 12448305 missense probably damaging 1.00
R4974:Lama3 UTSW 18 12552826 missense probably damaging 0.98
R4996:Lama3 UTSW 18 12518743 missense probably benign 0.24
R5049:Lama3 UTSW 18 12582611 missense probably benign 0.19
R5057:Lama3 UTSW 18 12531948 missense probably null 0.82
R5090:Lama3 UTSW 18 12542402 missense possibly damaging 0.94
R5122:Lama3 UTSW 18 12539766 missense possibly damaging 0.53
R5215:Lama3 UTSW 18 12577900 missense probably damaging 1.00
R5245:Lama3 UTSW 18 12419893 missense probably damaging 1.00
R5259:Lama3 UTSW 18 12465508 missense probably damaging 1.00
R5320:Lama3 UTSW 18 12552855 missense probably damaging 0.99
R5377:Lama3 UTSW 18 12453746 missense probably damaging 0.99
R5432:Lama3 UTSW 18 12572066 missense probably damaging 1.00
R5500:Lama3 UTSW 18 12456764 missense possibly damaging 0.93
R5534:Lama3 UTSW 18 12553210 missense probably benign 0.00
R5589:Lama3 UTSW 18 12472220 missense possibly damaging 0.46
R5604:Lama3 UTSW 18 12439348 missense probably benign
R5617:Lama3 UTSW 18 12498936 intron probably benign
R5709:Lama3 UTSW 18 12539799 missense probably damaging 1.00
R5965:Lama3 UTSW 18 12429887 missense possibly damaging 0.67
R6042:Lama3 UTSW 18 12574254 missense probably damaging 1.00
R6065:Lama3 UTSW 18 12469928 missense possibly damaging 0.53
R6085:Lama3 UTSW 18 12482099 missense probably benign 0.01
R6212:Lama3 UTSW 18 12513645 missense probably damaging 1.00
R6268:Lama3 UTSW 18 12524737 missense probably damaging 0.98
R6276:Lama3 UTSW 18 12506949 missense probably benign 0.02
R6366:Lama3 UTSW 18 12482137 missense probably damaging 1.00
R6393:Lama3 UTSW 18 12479756 missense probably benign 0.44
R6493:Lama3 UTSW 18 12482148 critical splice donor site probably null
R6505:Lama3 UTSW 18 12495348 missense probably benign 0.02
R6563:Lama3 UTSW 18 12537766 missense probably damaging 1.00
R6582:Lama3 UTSW 18 12577840 missense probably damaging 1.00
R6585:Lama3 UTSW 18 12419257 critical splice donor site probably null
R6609:Lama3 UTSW 18 12513678 missense probably damaging 0.99
R6656:Lama3 UTSW 18 12549226 missense possibly damaging 0.66
R6833:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R6834:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R7019:Lama3 UTSW 18 12528418 missense probably damaging 0.97
R7026:Lama3 UTSW 18 12516548 missense probably damaging 0.98
R7088:Lama3 UTSW 18 12582545 missense possibly damaging 0.90
R7100:Lama3 UTSW 18 12582644 missense possibly damaging 0.80
R7102:Lama3 UTSW 18 12552813 missense possibly damaging 0.66
R7103:Lama3 UTSW 18 12531879 missense probably benign 0.00
R7121:Lama3 UTSW 18 12462782 missense probably benign 0.06
R7133:Lama3 UTSW 18 12539786 missense probably benign 0.05
R7150:Lama3 UTSW 18 12468289 missense probably damaging 1.00
R7158:Lama3 UTSW 18 12456812 missense probably benign 0.20
R7170:Lama3 UTSW 18 12404076 missense probably benign 0.26
R7216:Lama3 UTSW 18 12430000 missense probably damaging 1.00
R7223:Lama3 UTSW 18 12582608 missense possibly damaging 0.53
R7243:Lama3 UTSW 18 12419845 missense probably damaging 1.00
R7282:Lama3 UTSW 18 12439392 missense probably damaging 0.99
R7337:Lama3 UTSW 18 12507040 splice site probably null
R7442:Lama3 UTSW 18 12472181 critical splice acceptor site probably null
R7487:Lama3 UTSW 18 12419237 missense probably benign
R7604:Lama3 UTSW 18 12500493 missense possibly damaging 0.93
R7609:Lama3 UTSW 18 12531834 critical splice acceptor site probably null
R7650:Lama3 UTSW 18 12537838 missense probably benign 0.01
R7894:Lama3 UTSW 18 12462807 missense probably benign 0.07
R7975:Lama3 UTSW 18 12537739 missense probably damaging 1.00
R8099:Lama3 UTSW 18 12534063 missense probably damaging 0.97
R8168:Lama3 UTSW 18 12506942 missense probably null
R8219:Lama3 UTSW 18 12439360 missense probably benign 0.07
R8227:Lama3 UTSW 18 12407551 missense probably benign
R8229:Lama3 UTSW 18 12407551 missense probably benign
R8298:Lama3 UTSW 18 12525853 missense probably benign 0.12
R8351:Lama3 UTSW 18 12540613 missense probably damaging 1.00
R8364:Lama3 UTSW 18 12528347 missense probably damaging 0.99
R8463:Lama3 UTSW 18 12449839 missense probably damaging 0.96
R8515:Lama3 UTSW 18 12411631 missense probably null 0.01
R8784:Lama3 UTSW 18 12421155 missense probably benign
R8799:Lama3 UTSW 18 12490943 missense probably damaging 0.96
R8874:Lama3 UTSW 18 12449586 critical splice donor site probably null
R8938:Lama3 UTSW 18 12556705 missense probably damaging 1.00
R8967:Lama3 UTSW 18 12532039 missense possibly damaging 0.46
R9039:Lama3 UTSW 18 12481063 nonsense probably null
R9126:Lama3 UTSW 18 12450470 missense probably damaging 1.00
R9200:Lama3 UTSW 18 12472240 missense probably benign 0.00
R9203:Lama3 UTSW 18 12462812 missense probably benign 0.04
R9246:Lama3 UTSW 18 12577902 missense probably damaging 0.99
R9284:Lama3 UTSW 18 12450484 nonsense probably null
R9553:Lama3 UTSW 18 12429962 missense probably damaging 1.00
R9716:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R9734:Lama3 UTSW 18 12549263 missense possibly damaging 0.94
X0019:Lama3 UTSW 18 12582574 missense possibly damaging 0.94
Z1177:Lama3 UTSW 18 12429879 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCGGGAATTTGAAACTCTGC -3'
(R):5'- ACATCAAGGAGCTTATTAACTCGAG -3'

Sequencing Primer
(F):5'- TTTGAAACTCTGCAAGAAAAGGTG -3'
(R):5'- CAAGGAGCTTATTAACTCGAGTGCTC -3'
Posted On 2014-09-18